Skip to content

GitLab

  • Projects
  • Groups
  • Snippets
  • Help
    • Loading...
  • Help
    • Help
    • Support
    • Community forum
    • Submit feedback
    • Contribute to GitLab
  • Sign in
O
OBITools
  • Project overview
    • Project overview
    • Details
    • Activity
    • Releases
  • Repository
    • Repository
    • Files
    • Commits
    • Branches
    • Tags
    • Contributors
    • Graph
    • Compare
  • Issues 30
    • Issues 30
    • List
    • Boards
    • Labels
    • Service Desk
    • Milestones
  • Merge Requests 0
    • Merge Requests 0
  • Operations
    • Operations
    • Incidents
  • Analytics
    • Analytics
    • Repository
    • Value Stream
  • Wiki
    • Wiki
  • Members
    • Members
  • Collapse sidebar
  • Activity
  • Graph
  • Create a new issue
  • Commits
  • Issue Boards
  • OBITools
  • OBITools
  • Issues
  • #55

Closed
Open
Opened May 04, 2020 by Lara Urban@lara.h.urban

asymmetry in simpleLCS()

Dear OBItools team,

I tried to understand how OBItools ECOTAG exactly finds the best matching hit, i.e how it determines the longest common substring (LCS) and the shortest alignment corresponding to this LCS.

I think that I found most of the source code here: https://git.metabarcoding.org/obitools/obitools/tree/master/src; if I compare two identical sequences with 'simpleLCS' (in src/obitools/align/_lcs.ext.1.c) and a base pair is added to the beginning of one of the sequences, this is evaluated as mismatch (i.e. LCS is reduced by one), whereas a base pair added to the end of a sequence is just being ignored (i.e. LCS stays the same). There seems to be an issue with symmetry; e.g. if: s1 = 'acccctttgcccatatcggccctagctctc' s2 = 'acccctttgcccatatcggccctagctct' s3 = 'cccctttgcccatatcggccctagctctc' then: simpleLCS(s1,s1), simpleLCS(s1,s2), simpleLCS(s2,s1), and simpleLCS(s1,s3) deliver the same values, but not simpleLCS(s3,s1).

Could you help me understand this, please?

Best regards, Lara

Assignee
Assign to
None
Milestone
None
Assign milestone
Time tracking
None
Due date
None
Reference: obitools/obitools#55