GitLab

Hello!

I am using OBITools to do a diet analysis for my fecal samples. I am running into an error when using the ngsfilter function:

(OBITools-1.2.13) ngsfilter -t /allmap_obi_trnl_trial_troubleshooting.txt -u unidentified.fastq Sample1.ali.fastq > Sample1.ali.assigned.fastq

This is the output when we used the flag --DEBUG.

  File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 426, in <module>
    primers=readTagfile(options.taglist)
  File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 227, in readTagfile
    "tag pair %s is already used with primer pairs : (%s,%s)" % (str(tags),forward,reverse)
AssertionError: tag pair (None, None) is already used with primer pairs : (D: gggcaatcctgagccaa,R: ccattgagtctctgcacctatc)
(OBITools-1.2.13) ngsfilter -t /allmap_obi_trnl_trial_troubleshooting.txt -u unidentified.fastq Sample1.ali.fastq > Sample1.ali.assigned.fastq --DEBUG
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
Traceback (most recent call last):
  File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 426, in <module>
    primers=readTagfile(options.taglist)
  File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 227, in readTagfile
    "tag pair %s is already used with primer pairs : (%s,%s)" % (str(tags),forward,reverse)
AssertionError: tag pair (None, None) is already used with primer pairs : (D: gggcaatcctgagccaa,R: ccattgagtctctgcacctatc)```

As barcodes had been removed in the original sequence processing and reads were already demultiplexed, `ngsfilter` was run with `-:-` in the mapping file in place of the barcode tag sequence. Mapping file example has been attached.

[allmap_obi_trnl_trial_troubleshooting.txt](/uploads/99c943a034647ad10a2616b746b9a338/allmap_obi_trnl_trial_troubleshooting.txt)

Does anyone have a similar problem or suggestion?