ngsfilter: AssertionError: tag pair
Hello, I am getting this error when trying to run the ngsfilter command-
"Traceback (most recent call last): File "/mnt/c/Users/Omer/Desktop/OBItools/OBITools-1.2.13/export/bin/ngsfilter", line 426, in primers=readTagfile(options.taglist) File "/mnt/c/Users/Omer/Desktop/OBItools/OBITools-1.2.13/export/bin/ngsfilter", line 227, in readTagfile "tag pair %s is already used with primer pairs : (%s,%s)" % (str(tags),forward,reverse) AssertionError: tag pair ('atgc', 'atgc') is already used with primer pairs : (D: ttcatctcagactgggattcagaaaggc,R: gcttggaaataaccctcctgcatccc)"
This is the command I wrote- "ngsfilter -t rawdata_GZ_2-22.ngsfilter.txt -u rawdata_GZ_2-22.unidentified.fastq rawdata_GZ_2-22.Alignement.fastq > rawdata_GZ_2-22.filtered.fastq"
Am I doing anything wrong? Thanks..