GitLab

ecoPCR is an electronic PCR software developed at LECA (http://www-leca.ujf-grenoble.fr/).

Here is the command I was running:

ecoPCR -d /Volumes/R5/Users/abonin/R119/embl_r119 -D 20 -e 6 -l 50 -L 600 CTTGGTCATTTAGAGGAAGTAA AGAYMMATGRTYAMAAGTTGT  > ITS1.ecopcr

Here is what I got after a little while:

Readind 1162548 taxa...
No local taxon
Reading file /Volumes/R5/Users/abonin/R119/embl_r119_001.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_002.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_003.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_004.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_005.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_006.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_007.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_008.sdx containing 700000 sequences...

Reading file /Volumes/R5/Users/abonin/R119/embl_r119_009.sdx containing 117641 sequences...

ecoPCR(49371) malloc: *** error for object 0x7f851b269998: incorrect checksum for freed object - object was probably modified after being freed.
*** set a breakpoint in malloc_error_break to debug
Abort

I tried the same command twice, same outcome except that the error message is now:

ecoPCR(53144) malloc: *** error for object 0x7f8f3c269998: incorrect checksum for freed object - object was probably modified after being freed.
*** set a breakpoint in malloc_error_break to debug
Abort

No hurry to solve it, it seems that with embl release 117 it works (but ecoPCR is still running...)