Commit efbcd978 by Pierre Taberlet

--no commit message

parent 64163e50
......@@ -151,22 +151,23 @@ The first sequence record of ``wolf.ali.ngs.fastq`` is:
.. code-block:: bash
@HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/1_CONS_SUB_SUB_CMP
ali_length=61; seq_ab_match=47; sminR=40.0; tail_quality=67.0;
reverse_match=ttagataccccactatgc; seq_a_deletion=1; sample=29a_F260619;
forward_match=tagaacaggctcctctag; forward_primer=tagaacaggctcctctag;
reverse_primer=ttagataccccactatgc; sminL=40.0; forward_score=72.0;
@HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/1_CONS_SUB_SUB status=full;
seq_ab_match=47; sminR=40.0; ali_length=61; tail_quality=67.0;
reverse_match=tagaacaggctcctctag; seq_a_deletion=1; sample=29a_F260619;
forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc;
reverse_primer=tagaacaggctcctctag; sminL=40.0; forward_score=72.0;
score=115.761290673; seq_a_mismatch=7; forward_tag=gcctcct; seq_b_mismatch=7;
experiment=wolf_diet; mid_quality=69.4210526316; avg_quality=69.1045751634;
seq_a_single=46; score_norm=1.89772607661; reverse_score=72.0;
direction=reverse; seq_b_insertion=0; seq_b_deletion=1; seq_a_insertion=0;
seq_length_ori=153; reverse_tag=gcctcct; seq_length=99; status=full;
mode=alignment; head_quality=67.0; seq_b_single=46;
aagggtataaagcaccgccaagtcctttgagttttaacctactcccgctacactctggcgaatgattttgttataataat
tacttgtgtttagggctaa
direction=forward; seq_b_insertion=0; seq_b_deletion=1; seq_a_insertion=0;
seq_length_ori=153; reverse_tag=gcctcct; seq_length=99; mode=alignment;
head_quality=67.0; seq_b_single=46;
ttagccctaaacacaagtaattattataacaaaatcattcgccagagtgtagcgggagtaggttaaaactcaaaggact
tggcggtgctttataccctt
+
addddaadcccWaaddabdx~~|b~~~~cccccccBcBcccBcBcccBccBcc~}`kXyxu|~Kyr`b~~~~~~b~~~b~
d\cdddddddddddddcac
cacdddddddddddddc\d~b~~~b~~~~~~b`ryK~|uxyXk`}~ccBccBcccBcBcccBcBccccccc~~~~b|~~
xdbaddaaWcccdaadddda
......@@ -201,19 +202,19 @@ The first sequence record of ``wolf.ali.ngs.uniq.fasta`` is:
.. code-block:: bash
>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/1_CONS_SUB_SUB_CMP
ali_length=61; seq_ab_match=47; sminR=40.0; tail_quality=67.0;
reverse_match=ttagataccccactatgc; seq_a_deletion=1;
forward_match=tagaacaggctcctctag; forward_primer=tagaacaggctcctctag;
reverse_primer=ttagataccccactatgc; sminL=40.0; merged_sample={'29a_F260619': 1};
>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/1_CONS_SUB_SUB ali_length=61;
seq_ab_match=47; sminR=40.0; tail_quality=67.0;
reverse_match=tagaacaggctcctctag; seq_a_deletion=1;
forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc;
reverse_primer=tagaacaggctcctctag; sminL=40.0; merged_sample={'29a_F260619': 1};
forward_score=72.0; seq_a_mismatch=7; forward_tag=gcctcct; seq_b_mismatch=7;
core=115.761290673; mid_quality=69.4210526316; avg_quality=69.1045751634;
score=115.761290673; mid_quality=69.4210526316; avg_quality=69.1045751634;
seq_a_single=46; score_norm=1.89772607661; reverse_score=72.0;
direction=reverse; seq_b_insertion=0; experiment=wolf_diet; seq_b_deletion=1;
direction=forward; seq_b_insertion=0; experiment=wolf_diet; seq_b_deletion=1;
seq_a_insertion=0; seq_length_ori=153; reverse_tag=gcctcct; count=1;
seq_length=99; status=full; mode=alignment; head_quality=67.0; seq_b_single=46;
aagggtataaagcaccgccaagtcctttgagttttaacctactcccgctacactctggcg
aatgattttgttataataattacttgtgtttagggctaa
ttagccctaaacacaagtaattattataacaaaatcattcgccagagtgtagcgggagta
ggttaaaactcaaaggacttggcggtgctttataccctt
The run of :doc:`obiuniq <scripts/obiuniq>` has added two key=values entries in the header of the fasta sequence :
- :py:mod:`merged_sample={'29a_F260619': 1}` : this sequence have been found once in a single sample
......@@ -231,26 +232,26 @@ The first five sequence records of ``wolf.ali.ngs.uniq.fasta`` becomes:
.. code-block:: bash
>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/1_CONS_SUB_SUB_CMP
merged_sample={'29a_F260619': 1}; count=1;
aagggtataaagcaccgccaagtcctttgagttttaacctactcccgctacactctggcg
aatgattttgttataataattacttgtgtttagggctaa
>HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1_CONS_SUB_SUB_CMP
merged_sample={'29a_F260619': 7, '15a_F730814': 2}; count=9;
aagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggc
gaacaattttgttatattaattacttgtgtttagggctaa
>HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/1_CONS_SUB_SUB_CMP
merged_sample={'29a_F260619': 5, '15a_F730814': 4}; count=9;
aagggtataaagcaccgccaagtcctttgagttttaagctcttgccggtagtactctggc
gaataattttgttatattaattacttgtgtttagggctaa
>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/1_CONS_SUB_SUB
merged_sample={'29a_F260619': 4697, '15a_F730814': 7638}; count=12335;
aagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggc
gaataattttgttatattaattacttgtgtttagggctaa
>HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/1_CONS_SUB_SUB_CMP
merged_sample={'26a_F040644': 10490}; count=10490;
agggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggc
gaacattcttgtttattgaatgtttatgtttagggctaa
>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/1_CONS_SUB_SUB
merged_sample={'29a_F260619': 1}; count=1;
ttagccctaaacacaagtaattattataacaaaatcattcgccagagtgtagcgggagta
ggttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1_CONS_SUB_SUB
merged_sample={'29a_F260619': 7, '15a_F730814': 2}; count=9;
ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/1_CONS_SUB_SUB
merged_sample={'29a_F260619': 5, '15a_F730814': 4}; count=9;
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaag
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/1_CONS_SUB_SUB_CMP
merged_sample={'29a_F260619': 4697, '15a_F730814': 7638}; count=12335;
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/1_CONS_SUB_SUB
merged_sample={'26a_F040644': 10490}; count=10490;
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
......@@ -324,11 +325,11 @@ The first sequence record of ``wolf.ali.ngs.uniq.c10.l80.fasta`` is:
.. code-block:: bash
>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/1_CONS_SUB_SUB count=12335;
merged_sample={'29a_F260619': 4697, '15a_F730814': 7638};
aagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggc
gaataattttgttatattaattacttgtgtttagggctaa
>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/1_CONS_SUB_SUB_CMP count=12335;
merged_sample={'29a_F260619': 4697, '15a_F730814': 7638};
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
Clean the sequences for PCR/sequencing errors (sequence variants)
......@@ -346,10 +347,17 @@ The first sequence record of ``wolf.ali.ngs.uniq.c10.l80.clean.fasta`` is:
.. code-block:: bash
>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/1_CONS_SUB_SUB count=12335;
merged_sample={'29a_F260619': 4697, '15a_F730814': 7638};
aagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggc
gaataattttgttatattaattacttgtgtttagggctaa
>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/1_CONS_SUB_SUB_CMP
merged_sample={'29a_F260619': 4697, '15a_F730814': 7638};
obiclean_count={'29a_F260619': 5438, '15a_F730814': 8642}; obiclean_head=True;
obiclean_cluster={'29a_F260619':
'HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/1_CONS_SUB_SUB_CMP',
'15a_F730814':
'HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/1_CONS_SUB_SUB_CMP'}; count=12335;
obiclean_internalcount=0; obiclean_status={'29a_F260619': 'h', '15a_F730814':
'h'}; obiclean_samplecount=2; obiclean_headcount=2; obiclean_singletoncount=0;
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment