--no commit message

doc/sphinx/source/wolves.rst

@@ -118,8 +118,8 @@ And the result is:
 	ccgcctcctttagataccccactatgcttagccctaaacacaagtaattattataacaaaatcattcgccagagtgtagc
 	gggagtaggttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
 	+
-	ddddddddddddddddddddddcddddcacdddddddddddddc\d~b~~~b~~~~~~b`ryK~|uxyXk`}~
-	ccBccBcccBcBcccBcBccccccc~~~~b|~~xdbaddaaWcccdaaddddadacddddddcddadbbddddddddddd
+	ddddddddddddddddddddddcddddcacdddddddddddddc\d~b~~~b~~~~~~b`ryK~|uxyXk`}~ccBccBc
+	ccBcBcccBcBccccccc~~~~b|~~xdbaddaaWcccdaaddddadacddddddcddadbbddddddddddd
 
 
 
@@ -275,7 +275,7 @@ the result in the unix commands ``sort`` and ``head`` we keep only the counting
 
 .. code-block:: bash
 
-   > obistat -c count CL-b.uniq.fasta | \
+   > obistat -c count wolf.ali.ngs.uniq.fasta |  \  
      sort -nk1 | head -20
 
 This print the output:
@@ -305,20 +305,31 @@ This print the output:
     
 The dataset contains 3504 sequences occurring only once.  
 
-TODO: Stopped here 
  
     
-Keep only the sequences having a count greater or equal to 10
-~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+Keep only the sequences having a count greater or equal to 10 and a length shorter than 80 bp
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
 
 Based on the previous observation, we set the cut-off for keeping sequences for further analysis to a count of 10. To do this, we use the :doc:`obigrep <scripts/obigrep>` command.
-The ``-p 'count>=10'`` option means that the ``python`` expression :py:mod:`count>=10` must be evaluated to :py:mod:`True` for each sequence to be kept.
+The ``-p 'count>=10'`` option means that the ``python`` expression :py:mod:`count>=10` must be evaluated to :py:mod:`True` for each sequence to be kept. We also remove 
+sequences with a length shorter than 80 bp (option -l).
 
 .. code-block:: bash
 
-   > obigrep -p 'count>=10' CL-b.uniq.fasta > CL-b.uniq.10.fasta
+   > obigrep -l 80 -p 'count>=10' wolf.ali.ngs.uniq.fasta \
+   	 > wolf.ali.ngs.uniq.c10.l80.fasta
+   	 
+   	 
+The first sequence record of ``wolf.ali.ngs.uniq.c10.l80.fasta`` is:
 
+.. code-block:: bash	 
 
+	>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/1_CONS_SUB_SUB count=12335; 
+	merged_sample={'29a_F260619': 4697, '15a_F730814': 7638}; 
+	aagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggc
+	gaataattttgttatattaattacttgtgtttagggctaa
+	
+	
 
 Clean the sequences for PCR/sequencing errors (sequence variants)
 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
@@ -329,7 +340,21 @@ sequences with no variants with 20-fold greater (``-r 0.05`` option).
 .. code-block:: bash
 
    > obiclean -s merged_sample -r 0.05 -H \
-     CL-b.uniq.10.fasta > CL-b.uniq.10.heads.fasta
+     wolf.ali.ngs.uniq.c10.l80.fasta > wolf.ali.ngs.uniq.c10.l80.clean.fasta 
+
+The first sequence record of ``wolf.ali.ngs.uniq.c10.l80.clean.fasta`` is:
+
+.. code-block:: bash
+
+	>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/1_CONS_SUB_SUB count=12335; 
+	merged_sample={'29a_F260619': 4697, '15a_F730814': 7638}; 
+	aagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggc
+	gaataattttgttatattaattacttgtgtttagggctaa
+
+
+
+TODO: Stopped here 
+
 
 
 Taxonomic assignment of sequences