Commit 0d4bb5bb by Eric Coissac

cleaning 2

parent ee53992a
......@@ -19,3 +19,5 @@
/OBITools-1.2.11/
/OBITools-1.2.12/
/obitools.test.old/
/coucou
/toto.fasta
>HWI-D00393:103:C6KCUANXX:2:2309:18209:70743_CONS_SUB_SUB reverse_score=72.0; count=2; direction=forward; experiment=australie; seq_a_mismatch=0; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; status=full; seq_a_deletion=0; seq_length=98; start=aaaac; merged_sample={'AN5-30_b': 1, 'AML-33_b': 1}; seq_a_insertion=0; mode=alignment; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
aaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagagtt
ggcataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2209:18639:37342_CONS_SUB_SUB_CMP ali_length=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-45_b': 1, 'AN2-30_a': 1}; forward_score=72.0; seq_b_mismatch=0; start=ataaa; experiment=australie; seq_a_single=33; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=2; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ataaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2115:3400:66119_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-03_a': 1}; forward_score=72.0; score=367.38470594; seq_a_mismatch=0; forward_tag=gtacgact; seq_b_mismatch=0; start=ccaaa; experiment=australie; mid_quality=62.0797101449; avg_quality=58.9050632911; seq_a_single=33; score_norm=3.99331202109; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=gtgtacat; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=03_03A; seq_b_single=33;
ccaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:2310:20070:75862_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=23.1; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN5-12_b': 1}; forward_score=72.0; score=360.189837214; seq_a_mismatch=0; forward_tag=catcagtc; seq_b_mismatch=0; start=ccaaa; experiment=australie; mid_quality=53.0507246377; avg_quality=49.6265822785; seq_a_single=33; score_norm=3.91510692624; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=cgagtcgt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=28.9; position=11_11D; seq_b_single=33;
ccaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggaataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2114:5633:21903_CONS_SUB_SUB merged_sample={'ABR-15_a': 1, 'AN5-12_b': 1, 'AW2-35_b': 1}; forward_score=72.0; seq_b_insertion=0; seq_a_insertion=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; count=3; seq_length=100; start=ccaaa; experiment=australie; reverse_score=72.0; mode=alignment; status=full; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ccaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1112:5602:81492_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN5-12_b': 1}; forward_score=72.0; score=367.699098517; seq_a_mismatch=0; forward_tag=catcagtc; seq_b_mismatch=0; start=ccaaa; experiment=australie; mid_quality=62.2463768116; avg_quality=59.0506329114; seq_a_single=33; score_norm=3.9967293317; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=cgagtcgt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_11D; seq_b_single=33;
ccaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtcttgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1101:4074:21538_CONS_SUB_SUB merged_sample={'AN4-36_b': 51, 'AW2-04_b': 11, 'AW2-04_a': 10, 'AN4-38_b': 158, 'AN5-43_b': 2, 'ADR-14_b': 2, 'AW2-34_b': 10, 'AW2-34_a': 1, 'AN3-38_b': 1, 'ABR-30_b': 1, 'AW2-36_b': 17, 'AN2-15_a': 11, 'AN4-34_b': 44, 'AN5-45_b': 5, 'AW2-27_b': 1, 'AW2-27_a': 3, 'ADR-25_a': 1, 'AN4-19_b': 30, 'ABR-44_a': 2, 'ABR-31_b': 1, 'AN2-20_b': 1, 'AN1-43_a': 2, 'AN2-13_b': 21, 'AN5-11_b': 2, 'AN4-22_b': 16, 'AN3-14_b': 1, 'AN3-14_a': 3, 'AW2-35_b': 101, 'AN2-19_b': 1, 'ABR-33_a': 1, 'ABR-29_a': 11, 'AW1-40_b': 9, 'ADR-13_a': 5, 'ADR-06_b': 1, 'AN4-26_a': 1, 'AN5-15_b': 20, 'AN2-01_a': 5, 'ADR-21_b': 1, 'AW2-23_b': 29, 'AW2-23_a': 3, 'ADR-13_b': 1, 'AW2-21_a': 1, 'AWO-27_b': 1, 'AW2-21_b': 20, 'AN2-10_a': 9, 'AN5-13_b': 19, 'AN4-20_b': 1, 'AN2-30_a': 1, 'AN3-22_b': 4, 'AN3-25_b': 3, 'AN3-25_a': 5, 'AN4-24_b': 26, 'ABR-15_a': 34, 'AW2-36_a': 5, 'AW2-12_b': 7, 'AW2-12_a': 5, 'AN5-48_a': 1, 'AW1-06_a': 6, 'AN5-21_a': 1, 'AN5-21_b': 20, 'AN2-09_b': 11, 'ABR-13_b': 2, 'ABR-13_a': 23, 'AN2-09_a': 7, 'AN3-20_b': 2, 'AN2-07_a': 4, 'AN2-07_b': 8, 'AN4-44_b': 26, 'AN4-21_b': 19, 'AW2-03_a': 28, 'AN4-42_b': 30, 'AW2-03_b': 47, 'ADR-26_b': 1, 'AN1-03_a': 6, 'AML-47_a': 1, 'AWO-30_b': 1, 'AN1-03_b': 3, 'ADR-30_b': 1, 'AN4-37_b': 40, 'AW2-07_b': 43, 'AN4-40_a': 1, 'AN3-44_b': 1, 'AN4-40_b': 36, 'AW2-01_b': 32, 'AW2-01_a': 13, 'AN5-10_b': 64, 'AW1-11_a': 29, 'AN2-43_a': 1, 'AN2-43_b': 2, 'AN1-17_a': 6, 'AN5-37_b': 1, 'blk-12_b': 1, 'ABR-35_b': 1, 'blk-02_b': 1, 'AN2-45_b': 8, 'AN3-40_a': 1, 'AW1-17_a': 5, 'AN2-45_a': 7, 'AW2-17_b': 4, 'ABR-25_a': 1, 'ABR-08_b': 1, 'AN5-14_b': 6, 'AWO-10_b': 1, 'AN2-38_a': 3, 'AN5-33_b': 15, 'AN2-12_a': 7, 'blk-04_b': 1, 'AN3-08_b': 4, 'AN3-01_b': 2, 'AN5-12_b': 106, 'ABR-23_a': 2, 'AN3-42_b': 19, 'AN4-23_b': 96, 'AN2-35_b': 1, 'ABR-02_a': 7, 'AN5-35_a': 1, 'ABR-17_a': 5, 'AML-42_a': 1, 'ADR-10_b': 1, 'ABR-39_a': 14, 'AN3-20_a': 3, 'pos-01_a': 1, 'AN5-03_b': 13, 'AN3-05_a': 1, 'AWO-42_b': 1, 'ABR-14_b': 1, 'AW2-13_b': 2, 'AW2-13_a': 5, 'blk-06_b': 2, 'AML-24_a': 1, 'ADR-12_b': 1, 'ABR-09_a': 3, 'ABR-12_b': 1, 'AN3-03_b': 3, 'AN3-03_a': 4, 'ABR-12_a': 34, 'ABR-27_b': 1, 'AN4-11_b': 15, 'AN5-22_b': 11, 'AN3-47_b': 2, 'AN3-47_a': 1, 'AN4-13_b': 35, 'AN2-41_b': 1, 'AN4-41_b': 14, 'AN4-22_a': 1, 'AN2-02_b': 5, 'ADR-37_b': 1, 'AN4-15_b': 2, 'AN5-20_a': 1, 'AN5-20_b': 18, 'AN3-45_b': 4, 'AW2-40_b': 20, 'AN5-09_b': 2, 'AN5-09_a': 1, 'AW2-40_a': 5, 'AN4-47_b': 11, 'AWO-19_b': 1, 'ABR-41_a': 12, 'AW1-32_b': 1, 'AW1-30_a': 15, 'AN4-05_a': 1, 'AN3-41_a': 1, 'AN3-46_b': 2, 'AN5-24_b': 35, 'ABR-43_a': 1, 'AW1-34_b': 1, 'AN5-30_b': 20, 'AN5-30_a': 1, 'AW2-28_a': 10, 'AW2-28_b': 5, 'AN5-25_b': 16, 'AN4-01_a': 1, 'AN2-04_b': 2, 'AW2-30_a': 22, 'AML-19_a': 1, 'AN2-34_a': 2, 'AN2-38_b': 3, 'pos-06_a': 1, 'AN5-19_b': 4, 'blk-07_b': 1, 'ABR-47_a': 1, 'AN2-02_a': 7, 'AN3-43_b': 12, 'AW1-20_a': 2, 'AW2-39_a': 3, 'AW2-43_a': 1, 'AWO-41_a': 10, 'AN5-38_a': 1, 'AW2-43_b': 3, 'AN4-17_b': 12, 'AW2-07_a': 48, 'AN3-04_b': 2, 'AN4-35_b': 86, 'AW1-26_a': 8, 'AWO-34_b': 1, 'ABR-14_a': 13, 'AN2-13_a': 4, 'AN4-39_a': 1, 'ABR-01_a': 78, 'AN5-44_b': 1, 'AN4-39_b': 85, 'AW1-30_b': 4, 'AN2-31_b': 7, 'AN3-37_a': 1, 'AN4-12_b': 142, 'AN3-35_b': 12, 'ABR-42_a': 9, 'ABR-03_b': 1, 'AN3-17_b': 19, 'AML-08_a': 2, 'AW1-29_a': 4, 'AN2-05_b': 3, 'AN4-46_b': 39, 'AN2-05_a': 5, 'AN4-14_b': 4, 'AN5-23_b': 24, 'AN4-25_a': 1, 'AML-12_a': 1, 'AN3-34_a': 1, 'AN5-28_b': 31, 'AN3-34_b': 2, 'AN5-27_b': 3, 'ABR-32_b': 1, 'AWO-15_b': 1, 'ABR-46_a': 8, 'AW1-18_a': 76, 'AN3-13_b': 1, 'AN4-18_b': 2, 'AN4-24_a': 1, 'AWO-06_b': 1, 'AN5-42_b': 14, 'ABR-28_a': 2, 'AN2-40_a': 2, 'AW1-40_a': 9, 'AW2-35_a': 70, 'ABR-40_b': 2, 'AN2-10_b': 3, 'AN3-27_b': 3, 'ABR-44_b': 1, 'ADR-38_b': 1, 'AN3-19_b': 2, 'ABR-40_a': 22, 'AN4-06_b': 17, 'ADR-05_b': 1, 'AN2-12_b': 1, 'ABR-08_a': 6, 'AN5-41_b': 10, 'AWO-37_b': 1, 'AN4-29_b': 40, 'AW2-42_b': 3, 'AW1-27_a': 6, 'ADR-34_b': 1, 'AN4-45_b': 115, 'AWO-13_b': 1, 'AN5-34_b': 73, 'ABR-22_b': 2, 'AN5-39_b': 2, 'AW2-42_a': 1, 'AN2-04_a': 4, 'AN4-43_b': 19, 'AW1-08_b': 1, 'AW1-08_a': 1, 'AW1-11_b': 1, 'AN4-48_a': 1, 'AML-04_a': 1, 'AML-41_a': 1, 'AW1-35_a': 2}; count=3190; seq_b_insertion=0; status=full; seq_a_deletion=0; seq_length=100; start=ctaaa; experiment=australie; seq_a_insertion=0; mode=alignment; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1102:20365:63690_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'ABR-13_a': 1}; forward_score=72.0; score=367.706336455; seq_a_mismatch=0; forward_tag=tagtcgca; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3333333333; avg_quality=59.1265822785; seq_a_single=33; score_norm=3.99680800494; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=cgctctcg; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=01_09E; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgctcgttga
>HWI-D00393:103:C6KCUANXX:2:1109:5898:71477_CONS_SUB_SUB_CMP merged_sample={'AW2-04_a': 1, 'AN4-38_b': 1, 'AW1-07_b': 1, 'AN4-34_b': 5, 'AN4-19_b': 1, 'AN2-20_b': 1, 'AN2-13_b': 3, 'AN5-11_b': 1, 'AN3-14_a': 1, 'ABR-29_a': 1, 'AW2-23_b': 3, 'AW2-23_a': 1, 'AN4-28_b': 1, 'AW2-21_b': 3, 'AN4-24_b': 1, 'AN5-21_b': 1, 'ABR-13_a': 2, 'AN3-20_b': 1, 'ADR-11_b': 1, 'AN4-44_b': 1, 'AN3-46_b': 2, 'AN4-42_b': 1, 'AW2-03_b': 2, 'AN1-03_a': 1, 'AN4-37_b': 2, 'AW2-07_b': 3, 'AN4-40_b': 3, 'AW2-01_a': 1, 'AW1-11_a': 5, 'AN2-43_b': 2, 'pos-09_a': 1, 'ABR-25_a': 1, 'AN2-38_b': 1, 'AN3-08_a': 1, 'AN3-01_b': 1, 'AN5-12_b': 2, 'AN3-42_b': 3, 'AN4-23_b': 1, 'ABR-02_a': 1, 'ABR-17_a': 1, 'ABR-39_a': 1, 'ABR-14_a': 3, 'AW2-13_b': 1, 'ABR-12_a': 4, 'AN4-13_b': 2, 'AN2-41_b': 1, 'AN4-15_b': 1, 'AN5-20_b': 1, 'AW2-40_b': 3, 'ABR-41_a': 1, 'AN3-35_a': 1, 'AN3-43_b': 1, 'AN5-24_b': 2, 'AN5-30_b': 1, 'AN5-34_b': 3, 'AN5-19_b': 1, 'AWO-41_a': 1, 'AN5-38_a': 1, 'AW2-07_a': 1, 'AN4-35_b': 5, 'ABR-01_a': 4, 'AN4-39_b': 2, 'AN2-31_b': 1, 'AW1-30_a': 1, 'AN4-12_b': 2, 'ABR-42_a': 2, 'AN3-17_a': 1, 'AN3-17_b': 1, 'AN2-05_b': 1, 'AN4-46_b': 1, 'AN4-14_b': 4, 'AN5-23_b': 4, 'ABR-32_a': 1, 'ABR-46_a': 2, 'AW1-18_a': 4, 'AN4-18_b': 1, 'AW1-35_a': 1, 'AW2-35_b': 6, 'AW1-40_b': 3, 'AW2-35_a': 2, 'AN2-10_a': 2, 'AN2-02_a': 1, 'AN4-29_b': 1, 'AN4-45_b': 3, 'AW2-44_b': 1, 'ABR-22_b': 1, 'AW1-28_b': 1, 'AW2-42_b': 1, 'AN4-43_b': 2, 'AW1-27_a': 1}; count=159; status=full; seq_a_deletion=0; seq_length=100; start=ctaaa; experiment=australie; seq_a_insertion=0; mode=alignment; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:1116:11515:15328_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-44_b': 1, 'AN4-39_b': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=2; seq_length=100; status=full; mode=alignment; head_quality=37.0; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttactaggttaaggtctcgtttgttaa
>HWI-D00393:103:C6KCUANXX:2:1206:17870:33853_CONS_SUB_SUB ali_length=92; seq_ab_match=92; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW1-30_a': 7}; forward_score=72.0; seq_a_mismatch=0; forward_tag=cgctctcg; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=gactgatg; goodAli=Alignement; count=7; seq_length=100; status=full; mode=alignment; position=02_12A; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcttaactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2106:7652:12042_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-40_b': 1, 'AW2-35_b': 1, 'ABR-01_a': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=3; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcgtaactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2115:4325:51738_CONS_SUB_SUB_CMP status=full; merged_sample={'AW1-29_a': 1, 'ABR-41_a': 1, 'AN2-02_a': 1, 'AN4-39_b': 1, 'AN2-07_a': 1}; seq_b_insertion=0; seq_a_insertion=0; seq_a_mismatch=0; forward_score=72.0; tail_quality=37.0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; count=5; seq_length=100; start=ctaaa; experiment=australie; reverse_score=72.0; mode=alignment; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgctaa
>HWI-D00393:103:C6KCUANXX:2:2211:17027:90962_CONS_SUB_SUB status=full; merged_sample={'AML-46_a': 1, 'AN4-46_b': 7}; seq_b_insertion=0; seq_a_insertion=0; seq_a_mismatch=0; forward_score=72.0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; count=8; seq_length=100; start=ctaaa; experiment=australie; reverse_score=72.0; mode=alignment; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcattcgttaa
>HWI-D00393:103:C6KCUANXX:2:1113:14380:43631_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-34_b': 1}; forward_score=72.0; score=367.706336455; seq_a_mismatch=0; forward_tag=atgatcgc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3333333333; avg_quality=59.1265822785; seq_a_single=33; score_norm=3.99680800494; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_08B; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagtatgtaaaggtctcgatcgttat
>HWI-D00393:103:C6KCUANXX:2:1116:10928:36920_CONS_SUB_SUB_CMP ali_length=92; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-38_b': 1, 'AN5-25_b': 1, 'AW2-01_a': 1}; forward_score=72.0; seq_a_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=3; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgtttgttaa
>HWI-D00393:103:C6KCUANXX:2:1204:11153:34132_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-38_b': 1, 'AN4-39_b': 1, 'AN2-31_b': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; status=full; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=3; seq_length=100; mode=alignment; head_quality=37.0; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactattcagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2106:2429:2922_CONS_SUB_SUB_CMP ali_length=93; seq_ab_match=93; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-38_b': 1}; forward_score=72.0; score=371.700731814; seq_a_mismatch=0; forward_tag=tctactga; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.7299270073; avg_quality=59.4522292994; seq_a_single=32; score_norm=3.99678206251; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=99; status=full; mode=alignment; head_quality=37.0; position=11_08F; seq_b_single=32;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggtaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2201:17654:97503_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=34.6; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN5-34_b': 1}; forward_score=72.0; score=307.231253197; seq_a_mismatch=0; forward_tag=tcagtgtc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=53.8115942029; avg_quality=51.4113924051; seq_a_single=33; score_norm=3.33947014344; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tcagtgtc; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=35.1; position=12_02B; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgtgaa
>HWI-D00393:103:C6KCUANXX:2:2206:15790:49247_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN5-24_b': 1, 'AWO-41_a': 1, 'AW2-35_a': 1, 'AN4-35_b': 1, 'AW2-07_a': 1, 'AN3-04_b': 1, 'AN2-13_a': 1, 'AN4-22_b': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=8; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttagggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2301:12930:40102_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'ABR-15_a': 1, 'AN4-39_b': 1}; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=2; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttaacaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2315:17692:90977_CONS_SUB_SUB_CMP ali_length=93; seq_a_deletion=0; reverse_score=72.0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-38_b': 1, 'ABR-41_a': 1, 'AN3-17_b': 1}; forward_score=72.0; seq_a_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=32; status=full; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; goodAli=Alignement; count=3; seq_length=99; mode=alignment; seq_b_single=32;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactattagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1207:9047:41800_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'ABR-13_a': 2, 'AN5-19_a': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=3; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgctcgttaa
>HWI-D00393:103:C6KCUANXX:2:2210:14421:16016_CONS_SUB_SUB_CMP reverse_score=66.0; count=7; direction=reverse; seq_b_insertion=0; experiment=australie; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_length=99; start=ctaaa; merged_sample={'AW2-12_b': 1, 'AN4-41_b': 1, 'AW2-07_a': 1, 'AN5-21_b': 1, 'AN2-15_a': 1, 'AN4-23_b': 1, 'AN4-37_b': 1}; seq_a_insertion=0; mode=alignment; status=full; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgtta
>HWI-D00393:103:C6KCUANXX:2:2211:13367:14752_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=32.6; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW1-18_a': 1}; forward_score=72.0; score=367.610399661; seq_a_mismatch=0; forward_tag=gtcacgtc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=61.0434782609; avg_quality=57.6329113924; seq_a_single=33; score_norm=3.9957652137; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=gtcgtaga; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=35.6; position=02_10C; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaagatctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:2307:6880:68904_CONS_SUB_SUB_CMP ali_length=81; seq_ab_match=56; tail_quality=37.0; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-37_b': 1}; forward_score=72.0; score=59.9384545346; seq_a_mismatch=1; forward_tag=atcagtca; seq_b_mismatch=22; start=ctaaa; experiment=australie; mid_quality=52.6666666667; avg_quality=50.6835443038; seq_a_single=33; score_norm=0.73998092018; reverse_score=72.0; direction=reverse; seq_b_insertion=2; seq_b_deletion=13; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_08E; seq_b_single=44;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaagtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1312:11682:89893_CONS_SUB_SUB_CMP ali_length=92; seq_a_deletion=0; reverse_score=72.0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-19_b': 1, 'AN5-10_b': 1, 'AN5-15_b': 1, 'AW2-34_b': 1, 'AN5-45_b': 1, 'AN4-40_b': 1}; forward_score=72.0; seq_a_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; status=full; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=6; seq_length=100; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcattaa
>HWI-D00393:103:C6KCUANXX:2:2109:18223:83128_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'ABR-15_a': 1, 'ABR-13_a': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=cgctctcg; goodAli=Alignement; count=2; seq_length=100; status=full; mode=alignment; head_quality=37.0; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttggcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2204:19781:26262_CONS_SUB_SUB_CMP ali_length=95; seq_ab_match=95; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'ABR-01_a': 1}; forward_score=72.0; score=379.691935178; seq_a_mismatch=0; forward_tag=gatcgcga; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=63.5703703704; avg_quality=60.1419354839; seq_a_single=30; score_norm=3.9967572124; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=155; reverse_tag=actagatc; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=01_07H; seq_b_single=30;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaagatctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2215:4598:28592_CONS_SUB_SUB_CMP status=full; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-40_b': 1, 'AW2-35_b': 1, 'AN5-03_b': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; goodAli=Alignement; count=3; seq_length=100; mode=alignment; head_quality=37.0;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggcctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2304:13327:3228_CONS_SUB_SUB merged_sample={'AN4-36_b': 1, 'AN4-29_b': 1, 'AW2-01_b': 1, 'AW2-35_a': 1, 'ABR-46_a': 1, 'AW1-18_a': 1, 'AW1-40_b': 1, 'AN4-24_b': 1, 'AW2-07_b': 2}; forward_score=72.0; seq_b_insertion=0; seq_a_insertion=0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; count=10; seq_length=100; start=ctaaa; experiment=australie; reverse_score=72.0; mode=alignment; status=full; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtcccgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1208:20375:7918_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; seq_a_deletion=0; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-37_b': 1, 'AW2-30_a': 1, 'AN4-35_b': 1}; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=3; seq_length=100; status=full; mode=alignment; head_quality=37.0; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcatagctatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1215:20045:28654_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-12_b': 1, 'AN5-42_b': 1, 'AN4-23_b': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=3; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcctaactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1302:19280:14816_CONS_SUB_SUB_CMP status=full; merged_sample={'ABR-01_a': 1, 'AWO-46_b': 1, 'AN4-22_b': 1}; seq_b_insertion=0; seq_a_mismatch=0; forward_score=72.0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; count=3; seq_length=100; start=ctaaa; experiment=australie; seq_a_insertion=0; mode=alignment; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgtacgttaa
>HWI-D00393:103:C6KCUANXX:2:2214:8779:29491_CONS_SUB_SUB_CMP status=full; merged_sample={'AN5-24_b': 1, 'ADR-13_a': 2, 'AW2-35_a': 1}; seq_b_insertion=0; seq_a_insertion=0; forward_score=72.0; reverse_match=tttgtctgcttaattgcg; seq_b_mismatch=0; seq_a_deletion=0; count=4; seq_length=100; start=ctaaa; experiment=australie; reverse_score=72.0; mode=alignment; seq_b_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; head_quality=37.0; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggctaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2104:3449:54357_CONS_SUB_SUB_CMP status=full; merged_sample={'AN4-13_b': 1, 'AN4-42_b': 1, 'AN4-38_b': 1, 'AN5-21_b': 1, 'AN4-46_b': 1, 'AN4-12_b': 6}; seq_b_insertion=0; seq_a_mismatch=0; forward_score=72.0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; count=11; seq_length=100; start=ctaaa; experiment=australie; seq_a_insertion=0; mode=alignment; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgttag
>HWI-D00393:103:C6KCUANXX:2:1102:14455:71108_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-23_b': 1}; forward_score=72.0; score=367.706336455; seq_a_mismatch=0; forward_tag=actagatc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3333333333; avg_quality=59.1265822785; seq_a_single=33; score_norm=3.99680800494; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=ctatgcta; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=09_05G; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgtcag
>HWI-D00393:103:C6KCUANXX:2:1110:14996:73808_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-43_b': 1, 'AW2-40_b': 1, 'AW2-07_b': 2}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=4; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagtaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1204:14078:1983_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-13_b': 1}; forward_score=72.0; score=367.706336455; seq_a_mismatch=0; forward_tag=tagtcgca; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3333333333; avg_quality=59.1265822785; seq_a_single=33; score_norm=3.99680800494; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=atatagcg; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=09_04E; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttactaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1212:8502:98185_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-37_b': 1, 'AW2-35_a': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=2; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcatgactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1305:7874:81774_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-07_a': 1, 'AN4-34_b': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=2; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtcttgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1103:10874:79989_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-35_b': 1}; forward_score=72.0; score=367.706336455; seq_a_mismatch=0; forward_tag=gtgtacat; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3333333333; avg_quality=59.1265822785; seq_a_single=33; score_norm=3.99680800494; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=agcacagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=09_07C; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttcaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1207:7817:59077_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-38_b': 1}; forward_score=72.0; score=366.948065081; seq_a_mismatch=0; forward_tag=tctactga; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=60.9420289855; avg_quality=57.9113924051; seq_a_single=33; score_norm=3.9885659248; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_08F; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgatcgttat
>HWI-D00393:103:C6KCUANXX:2:1308:2120:40513_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN3-42_b': 1}; forward_score=72.0; score=367.703923809; seq_a_mismatch=0; forward_tag=atgatcgc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3043478261; avg_quality=59.1012658228; seq_a_single=33; score_norm=3.99678178053; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=actctgct; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_03B; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcattcgttat
>HWI-D00393:103:C6KCUANXX:2:2206:6280:74968_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=acacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-40_a': 1}; forward_score=66.0; score=367.706336455; seq_a_mismatch=0; forward_tag=gatcgcga; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3333333333; avg_quality=59.1265822785; seq_a_single=33; score_norm=3.99680800494; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=catcagtc; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=05_08H; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttgaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1215:13979:31122_CONS_SUB_SUB_CMP ali_length=93; seq_ab_match=93; tail_quality=37.0; reverse_match=tttgttgcttaattgcga; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-34_b': 1}; forward_score=72.0; score=371.70314446; seq_a_mismatch=0; forward_tag=atgatcgc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.6861313869; avg_quality=59.4140127389; seq_a_single=32; score_norm=3.99680800494; reverse_score=66.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=99; status=full; mode=alignment; head_quality=37.0; position=11_08B; seq_b_single=32;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggtaagggtctcgttcgtta
>HWI-D00393:103:C6KCUANXX:2:2208:15903:75212_CONS_SUB_SUB ali_length=92; seq_ab_match=91; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-01_b': 1}; forward_score=72.0; score=359.811368897; seq_a_mismatch=1; forward_tag=actagatc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.0072463768; avg_quality=58.8417721519; seq_a_single=33; score_norm=3.91099314019; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tcagtgtc; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=09_02G; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagtaggttaaggtctcgtttgttaa
>HWI-D00393:103:C6KCUANXX:2:1203:16969:99847_CONS_SUB_SUB ali_length=92; seq_ab_match=91; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-40_b': 1}; forward_score=72.0; score=359.526419012; seq_a_mismatch=0; forward_tag=ctgcgtac; seq_b_mismatch=1; start=ctaaa; experiment=australie; mid_quality=60.9782608696; avg_quality=57.9430379747; seq_a_single=33; score_norm=3.90789585883; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_08H; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataacaatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2213:12449:50581_CONS_SUB_SUB_CMP status=full; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-45_b': 1, 'AN5-25_b': 1, 'AN4-22_b': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; goodAli=Alignement; count=3; seq_length=100; mode=alignment; head_quality=37.0;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggtataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2310:15600:75905_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-03_a': 1}; forward_score=72.0; score=367.701511163; seq_a_mismatch=0; forward_tag=gtacgact; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.2753623188; avg_quality=59.0759493671; seq_a_single=33; score_norm=3.99675555612; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=gtgtacat; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=03_03A; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggtaagggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:1214:16466:5047_CONS_SUB_SUB status=full; merged_sample={'AN2-07_b': 1, 'AN1-17_a': 1, 'AN3-25_b': 1, 'AN4-23_b': 1, 'AW2-35_a': 1}; seq_b_insertion=0; seq_a_insertion=0; seq_a_mismatch=0; forward_score=72.0; seq_b_deletion=0; seq_a_deletion=0; count=5; seq_length=100; start=ctaaa; experiment=australie; reverse_score=72.0; mode=alignment; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcgggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1306:6166:18686_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=24.8; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-39_b': 1}; forward_score=72.0; score=200.442729055; seq_a_mismatch=0; forward_tag=gatgatct; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=40.5289855072; avg_quality=38.6898734177; seq_a_single=33; score_norm=2.17872531582; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=27.2; position=11_08G; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggctagagtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2312:19984:25051_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-03_b': 1}; forward_score=72.0; score=367.703923809; seq_a_mismatch=0; forward_tag=acacacac; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3043478261; avg_quality=59.1012658228; seq_a_single=33; score_norm=3.99678178053; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=actctgct; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=09_03A; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttagagtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:1209:10424:5048_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-43_b': 1}; forward_score=72.0; score=367.706336455; seq_a_mismatch=0; forward_tag=acgacgag; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3333333333; avg_quality=59.1265822785; seq_a_single=33; score_norm=3.99680800494; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=agtgctac; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_09C; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggataaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:1306:10017:29340_CONS_SUB_SUB_CMP merged_sample={'AN4-36_b': 1, 'AN4-12_b': 1, 'AW2-07_a': 1}; forward_score=72.0; direction=reverse; seq_b_insertion=0; seq_a_insertion=0; seq_a_mismatch=0; seq_b_deletion=0; status=full; seq_a_deletion=0; count=3; seq_length=100; start=ctaaa; experiment=australie; reverse_score=72.0; mode=alignment; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttagcataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1116:1609:19254_CONS_SUB_SUB ali_length=93; seq_ab_match=93; tail_quality=34.4; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-45_b': 1}; forward_score=72.0; score=365.502727331; seq_a_mismatch=0; forward_tag=atcagtca; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=55.8905109489; avg_quality=52.9936305732; seq_a_single=32; score_norm=3.93013685302; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; reverse_tag=agtgctac; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=31.9; position=11_09E; seq_b_single=32;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgtttt
>HWI-D00393:103:C6KCUANXX:2:1116:18814:29744_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-35_a': 1}; forward_score=72.0; score=367.048675141; seq_a_mismatch=0; forward_tag=acgacgag; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=61.7101449275; avg_quality=58.582278481; seq_a_single=33; score_norm=3.9896595124; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=actagatc; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=03_07C; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcagattaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1301:18017:5670_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=91; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-29_b': 1}; forward_score=72.0; score=307.503017136; seq_a_mismatch=0; forward_tag=atcagtca; seq_b_mismatch=1; start=ctaaa; experiment=australie; mid_quality=48.0362318841; avg_quality=46.0632911392; seq_a_single=33; score_norm=3.3424240993; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=agcacagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=27.9; position=11_07E; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagccggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2304:14057:23271_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'ADR-47_b': 1, 'AN3-35_b': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=2; seq_length=100; status=full; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataattatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1105:1482:86390_CONS_SUB_SUB_CMP ali_length=94; seq_ab_match=94; tail_quality=37.0; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN5-13_b': 1}; forward_score=72.0; score=375.690301881; seq_a_mismatch=0; forward_tag=atcagtca; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=63.0735294118; avg_quality=59.7307692308; seq_a_single=31; score_norm=3.99670533916; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=156; reverse_tag=cgagtcgt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_11E; seq_b_single=31;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgtaaa
>HWI-D00393:103:C6KCUANXX:2:1214:1498:16792_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=36.4; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-01_a': 1}; forward_score=72.0; score=367.691974388; seq_a_mismatch=0; forward_tag=gatgatct; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.2608695652; avg_quality=59.0253164557; seq_a_single=33; score_norm=3.99665189552; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=acagcaca; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=03_02G; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggctgaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2112:6296:18402_CONS_SUB_SUB_CMP reverse_score=72.0; count=2; direction=reverse; seq_b_insertion=0; experiment=australie; seq_b_deletion=0; status=full; seq_a_deletion=0; seq_length=100; start=ctaaa; merged_sample={'AN4-11_b': 1, 'AN4-17_b': 1}; seq_a_insertion=0; mode=alignment; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggaataactatttagcaggttaaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:2202:15115:92220_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-35_b': 1}; forward_score=72.0; score=367.703923809; seq_a_mismatch=0; forward_tag=gtgtacat; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3043478261; avg_quality=59.1012658228; seq_a_single=33; score_norm=3.99678178053; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=agcacagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=09_07C; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggtccgggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2308:15218:31319_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=35.1; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN5-30_a': 1}; forward_score=72.0; score=367.379880648; seq_a_mismatch=0; forward_tag=gcgtcagc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=61.7463768116; avg_quality=58.4936708861; seq_a_single=33; score_norm=3.99325957226; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=agactatg; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=06_01F; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactagttagcaggttaaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:1303:8962:10788_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=91; tail_quality=35.6; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-40_b': 1}; forward_score=72.0; score=328.577396734; seq_a_mismatch=0; forward_tag=ctgcgtac; seq_b_mismatch=1; start=ctaaa; experiment=australie; mid_quality=51.2898550725; avg_quality=49.2721518987; seq_a_single=33; score_norm=3.57149344276; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=35.1; position=11_08H; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactttttagcaggttaaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:1309:18593:53694_CONS_SUB_SUB_CMP ali_length=92; seq_a_deletion=0; reverse_score=72.0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN5-43_b': 1, 'ABR-41_a': 1, 'AW2-35_a': 1}; forward_score=72.0; seq_a_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; status=full; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=3; seq_length=100; mode=alignment; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactacttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1208:4517:87099_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-03_a': 1}; forward_score=72.0; score=367.701511163; seq_a_mismatch=0; forward_tag=gtacgact; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.2753623188; avg_quality=59.0759493671; seq_a_single=33; score_norm=3.99675555612; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=gtgtacat; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=03_03A; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagaaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1115:14275:7184_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-45_b': 1}; forward_score=72.0; score=367.706336455; seq_a_mismatch=0; forward_tag=atcagtca; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3333333333; avg_quality=59.1265822785; seq_a_single=33; score_norm=3.99680800494; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=agtgctac; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_09E; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttagagtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1209:11513:82442_CONS_SUB_SUB_CMP ali_length=94; seq_ab_match=94; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-39_a': 1}; forward_score=72.0; score=375.685590398; seq_a_mismatch=0; forward_tag=gatgatct; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=63.0294117647; avg_quality=59.6923076923; seq_a_single=31; score_norm=3.996655217; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=156; reverse_tag=actagatc; goodAli=Alignement; count=1; seq_length=98; status=full; mode=alignment; head_quality=37.0; position=03_07G; seq_b_single=31;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1214:6399:72570_CONS_SUB_SUB ali_length=92; seq_ab_match=88; tail_quality=24.5; reverse_match=tttgtctgcttaattacg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-30_a': 1}; forward_score=72.0; score=255.892896628; seq_a_mismatch=3; forward_tag=tctactga; seq_b_mismatch=1; start=ctaaa; experiment=australie; mid_quality=40.4057971014; avg_quality=38.5253164557; seq_a_single=33; score_norm=2.78144452857; reverse_score=66.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tactatac; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=26.6; position=03_06F; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgtgcgttaa
>HWI-D00393:103:C6KCUANXX:2:1305:3473:19356_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-07_b': 1}; forward_score=72.0; score=367.635869076; seq_a_mismatch=0; forward_tag=tactatac; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=61.9782608696; avg_quality=58.8164556962; seq_a_single=33; score_norm=3.99604205518; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=actctgct; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=09_03F; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcgtaactatttagcaggttaaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:2302:5940:68325_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-37_b': 1}; forward_score=72.0; score=367.706336455; seq_a_mismatch=0; forward_tag=atcagtca; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3333333333; avg_quality=59.1265822785; seq_a_single=33; score_norm=3.99680800494; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_08E; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggtcgaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:2309:13769:62059_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=91; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-35_a': 1}; forward_score=72.0; score=359.470664833; seq_a_mismatch=0; forward_tag=acgacgag; seq_b_mismatch=1; start=ctaaa; experiment=australie; mid_quality=61.7536231884; avg_quality=58.6202531646; seq_a_single=33; score_norm=3.90728983514; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=actagatc; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=03_07C; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaagttctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2315:8947:22476_CONS_SUB_SUB ali_length=93; seq_ab_match=93; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN3-25_a': 1}; forward_score=72.0; score=368.159719936; seq_a_mismatch=0; forward_tag=acacacac; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=58.4744525547; avg_quality=55.7388535032; seq_a_single=32; score_norm=3.95870666598; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; reverse_tag=agactatg; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=05_01A; seq_b_single=32;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactgtttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1301:19819:95569_CONS_SUB_SUB_CMP ali_length=94; seq_ab_match=94; tail_quality=37.0; reverse_match=tttgtctttaattccgat; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN5-34_b': 1}; forward_score=72.0; score=375.699952465; seq_a_mismatch=0; forward_tag=tcagtgtc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=63.1911764706; avg_quality=59.8333333333; seq_a_single=31; score_norm=3.99680800494; reverse_score=60.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=156; reverse_tag=tcagtgtc; goodAli=Alignement; count=1; seq_length=98; status=full; mode=alignment; head_quality=37.0; position=12_02B; seq_b_single=31;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgtt
>HWI-D00393:103:C6KCUANXX:2:1313:4613:34271_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=32.3; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW1-11_a': 1}; forward_score=72.0; score=313.551003229; seq_a_mismatch=0; forward_tag=gtcacgtc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=56.6594202899; avg_quality=53.1518987342; seq_a_single=33; score_norm=3.40816307858; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=cgctctcg; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=25.6; position=02_09C; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggtcaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2113:10988:9799_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=30.2; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN5-13_b': 1}; forward_score=72.0; score=361.020650934; seq_a_mismatch=0; forward_tag=atcagtca; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=55.6086956522; avg_quality=52.4936708861; seq_a_single=33; score_norm=3.92413751015; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=cgagtcgt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=31.8; position=11_11E; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaatgtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2113:5686:82397_CONS_SUB_SUB_CMP ali_length=93; seq_ab_match=93; tail_quality=36.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'blk-12_b': 1}; forward_score=72.0; score=371.343139227; seq_a_mismatch=0; forward_tag=ctatgcta; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.1532846715; avg_quality=58.7643312102; seq_a_single=32; score_norm=3.99293698094; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; reverse_tag=ctgcgtac; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=35.1; position=08_12E; seq_b_single=32;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggatagggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:2311:15976:57660_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=91; tail_quality=30.1; reverse_match=tttgtctggttaattccg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-39_b': 1}; forward_score=72.0; score=346.55597612; seq_a_mismatch=0; forward_tag=gatgatct; seq_b_mismatch=1; start=ctaaa; experiment=australie; mid_quality=56.8550724638; avg_quality=53.8037974684; seq_a_single=33; score_norm=3.76691278391; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=35.4; position=11_08G; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggtgaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2205:20527:78743_CONS_SUB_SUB ali_length=95; seq_ab_match=93; tail_quality=29.1; reverse_match=tttgtctgcttaatggcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-12_b': 1}; forward_score=72.0; score=351.353534518; seq_a_mismatch=1; forward_tag=catcagtc; seq_b_mismatch=1; start=ctaaa; experiment=australie; mid_quality=50.2074074074; avg_quality=47.8709677419; seq_a_single=30; score_norm=3.69845825808; reverse_score=66.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=155; reverse_tag=ctatgcta; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=35.1; position=11_05D; seq_b_single=30;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtcgcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1104:5688:6100_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-46_b': 1}; forward_score=72.0; score=367.370471331; seq_a_mismatch=0; forward_tag=tctactga; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.0362318841; avg_quality=58.8670886076; seq_a_single=33; score_norm=3.99315729707; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=agtgctac; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_09F; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtcccattcgttaa
>HWI-D00393:103:C6KCUANXX:2:1111:18652:56309_CONS_SUB_SUB ali_length=93; seq_ab_match=93; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN2-12_a': 1}; forward_score=72.0; score=371.700731814; seq_a_mismatch=0; forward_tag=atatagcg; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.7299270073; avg_quality=59.4522292994; seq_a_single=32; score_norm=3.99678206251; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; reverse_tag=tatgtcag; goodAli=Alignement; count=1; seq_length=99; status=full; mode=alignment; head_quality=37.0; position=04_04D; seq_b_single=32;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttgttaa
>HWI-D00393:103:C6KCUANXX:2:1211:20612:10566_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-38_b': 1}; forward_score=72.0; score=367.703923809; seq_a_mismatch=0; forward_tag=tctactga; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3043478261; avg_quality=59.1012658228; seq_a_single=33; score_norm=3.99678178053; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_08F; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataaccatttagctggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2113:19027:63568_CONS_SUB_SUB_CMP ali_length=93; seq_ab_match=93; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-38_b': 1}; forward_score=72.0; score=371.700731814; seq_a_mismatch=0; forward_tag=tctactga; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.7299270073; avg_quality=59.4267515924; seq_a_single=32; score_norm=3.99678206251; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=36.6; position=11_08F; seq_b_single=32;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagtaggctagagtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:2201:15565:85738_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=32.1; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-23_b': 1}; forward_score=72.0; score=365.670520501; seq_a_mismatch=0; forward_tag=actagatc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=59.5289855072; avg_quality=56.3670886076; seq_a_single=33; score_norm=3.97467957066; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=ctatgcta; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=09_05G; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcatatctatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2215:13270:16769_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-01_b': 1}; forward_score=72.0; score=367.703923809; seq_a_mismatch=0; forward_tag=actagatc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3043478261; avg_quality=59.1012658228; seq_a_single=33; score_norm=3.99678178053; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tcagtgtc; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=09_02G; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgtccgttaa
>HWI-D00393:103:C6KCUANXX:2:1102:18567:11128_CONS_SUB_SUB_CMP ali_length=93; seq_ab_match=93; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN2-10_b': 1}; forward_score=72.0; score=370.995083415; seq_a_mismatch=0; forward_tag=gtcgtaga; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=61.8248175182; avg_quality=58.5732484076; seq_a_single=32; score_norm=3.98919444533; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; reverse_tag=atatagcg; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=35.6; position=10_04B; seq_b_single=32;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttgacataactatttagcaggttaaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:1106:7644:40758_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=90; tail_quality=34.2; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-35_b': 1}; forward_score=72.0; score=296.115079326; seq_a_mismatch=2; forward_tag=acgacgag; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=54.1449275362; avg_quality=51.6075949367; seq_a_single=33; score_norm=3.21864216659; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=tagctagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=34.0; position=11_08C; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgttac
>HWI-D00393:103:C6KCUANXX:2:1111:17524:16890_CONS_SUB_SUB ali_length=94; seq_ab_match=94; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN2-12_b': 1}; forward_score=72.0; score=375.680651297; seq_a_mismatch=0; forward_tag=gactgatg; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.9264705882; avg_quality=59.6025641026; seq_a_single=31; score_norm=3.99660267337; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=156; reverse_tag=atatagcg; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=10_04D; seq_b_single=31;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttgtcataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2109:4640:21588_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN5-10_b': 1}; forward_score=72.0; score=367.701511163; seq_a_mismatch=0; forward_tag=atgatcgc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.2173913043; avg_quality=59.0253164557; seq_a_single=33; score_norm=3.99675555612; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=cgagtcgt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_11B; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcggtcgttaa
>HWI-D00393:103:C6KCUANXX:2:2212:14824:56282_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW1-11_a': 1}; forward_score=72.0; score=367.703923809; seq_a_mismatch=0; forward_tag=gtcacgtc; seq_b_mismatch=0; start=ctaaa; experiment=australie; mid_quality=62.3043478261; avg_quality=59.1012658228; seq_a_single=33; score_norm=3.99678178053; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=cgctctcg; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=02_09C; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggtcaaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:2306:10336:10418_CONS_SUB_SUB ali_length=92; seq_ab_match=92; tail_quality=37.0; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW2-35_b': 1, 'AN4-23_b': 1}; forward_score=72.0; seq_a_mismatch=0; seq_b_mismatch=0; start=ctaaa; experiment=australie; seq_a_single=33; reverse_score=72.0; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; goodAli=Alignement; count=2; seq_length=100; status=full; mode=alignment; head_quality=37.0; seq_b_single=33;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataaccatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2216:11206:55822_CONS_SUB_SUB_CMP ali_length=93; seq_ab_match=92; tail_quality=29.8; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AW1-30_a': 1}; forward_score=72.0; score=357.173125277; seq_a_mismatch=0; forward_tag=cgctctcg; seq_b_mismatch=1; start=ctaaa; experiment=australie; mid_quality=54.6642335766; avg_quality=51.4777070064; seq_a_single=32; score_norm=3.84057123954; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; reverse_tag=gactgatg; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=29.5; position=02_12A; seq_b_single=32;
ctaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcttaactatttagcaggttaaggtctcgttcgttat
>HWI-D00393:103:C6KCUANXX:2:2303:4215:99753_CONS_SUB_SUB ali_length=93; seq_ab_match=93; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgtattgcc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-41_b': 1}; forward_score=66.0; score=371.70314446; seq_a_mismatch=0; forward_tag=gtacgact; seq_b_mismatch=0; start=gaaaa; experiment=australie; mid_quality=62.7591240876; avg_quality=59.4522292994; seq_a_single=32; score_norm=3.99680800494; reverse_score=72.0; direction=forward; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=157; reverse_tag=agtgctac; goodAli=Alignement; count=1; seq_length=99; status=full; mode=alignment; head_quality=36.6; position=11_09A; seq_b_single=32;
gaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagagt
tggcataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2209:18822:35652_CONS_SUB_SUB_CMP ali_length=92; seq_ab_match=92; tail_quality=37.0; reverse_match=tttgtctgcttaattgcg; seq_a_deletion=0; forward_match=tcacagacctgttattgc; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; merged_sample={'AN4-29_b': 1}; forward_score=72.0; score=366.357546614; seq_a_mismatch=0; forward_tag=atcagtca; seq_b_mismatch=0; start=gtaaa; experiment=australie; mid_quality=60.7898550725; avg_quality=57.7784810127; seq_a_single=33; score_norm=3.98214724581; reverse_score=72.0; direction=reverse; seq_b_insertion=0; seq_b_deletion=0; seq_a_insertion=0; seq_length_ori=158; reverse_tag=agcacagt; goodAli=Alignement; count=1; seq_length=100; status=full; mode=alignment; head_quality=37.0; position=11_07E; seq_b_single=33;
gtaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttggcataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:2212:12163:84900_CONS_SUB_SUB merged_sample={'AN4-36_b': 1, 'AN4-39_b': 1, 'AN4-12_b': 1, 'AW2-03_b': 1, 'ABR-42_a': 1, 'AN4-46_b': 1, 'AN4-23_b': 1, 'AN4-37_b': 1, 'AN5-23_b': 1, 'AN5-41_b': 1, 'AW1-18_a': 1, 'AN4-35_b': 1, 'AW2-35_b': 1, 'AW2-35_a': 1}; reverse_score=72.0; seq_b_insertion=0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; count=14; seq_length=99; start=taaaa; experiment=australie; seq_a_insertion=0; mode=alignment; status=full; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; goodAli=Alignement;
taaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagagt
tggcataactatttagcaggttaaggtctcgttcgttaa
>HWI-D00393:103:C6KCUANXX:2:1210:8971:79507_CONS_SUB_SUB_CMP merged_sample={'AN5-41_b': 1, 'AW2-01_a': 3, 'AN5-25_b': 2, 'AW2-07_b': 4, 'AN5-23_b': 3, 'AW2-01_b': 1}; ali_length=92; seq_b_insertion=0; seq_b_deletion=0; status=full; seq_a_deletion=0; count=14; seq_length=100; start=ttaaa; experiment=australie; seq_a_insertion=0; mode=alignment; seq_length_ori=158; forward_primer=tcacagacctgttattgc; reverse_primer=tttgtctgsttaattscg; seq_a_single=33; seq_b_single=33; goodAli=Alignement;
ttaaaacttccgtcggctaatcgccgacagtccctctaagaagttgactaccaacgagag
ttagcataactattcagtaggttaaggtctcgttcgttaa
This source diff could not be displayed because it is too large. You can view the blob instead.
/toto.adx
/toto.ndx
/toto.rdx
/toto.tdx
/toto_001.sdx
/toto_002.sdx
/toto_003.sdx
/a.fasta
/b.fasta
/c.fasta
/tmp/
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment