OBITools issueshttps://git.metabarcoding.org/obitools/obitools/-/issues2020-01-18T00:09:37Zhttps://git.metabarcoding.org/obitools/obitools/-/issues/50Error in ngsfilter: AssertionError: tag pair (None, None) is already used wit...2020-01-18T00:09:37ZLotte SkovmandError in ngsfilter: AssertionError: tag pair (None, None) is already used with primer pairsHello!
I am using OBITools to do a diet analysis for my fecal samples. I am running into an error when using the ngsfilter function:
`(OBITools-1.2.13) ngsfilter -t /allmap_obi_trnl_trial_troubleshooting.txt -u unidentified.fastq Sample1.ali.fastq > Sample1.ali.assigned.fastq`
This is the output when we used the flag `--DEBUG`.
```Traceback (most recent call last):
File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 426, in <module>
primers=readTagfile(options.taglist)
File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 227, in readTagfile
"tag pair %s is already used with primer pairs : (%s,%s)" % (str(tags),forward,reverse)
AssertionError: tag pair (None, None) is already used with primer pairs : (D: gggcaatcctgagccaa,R: ccattgagtctctgcacctatc)
(OBITools-1.2.13) ngsfilter -t /allmap_obi_trnl_trial_troubleshooting.txt -u unidentified.fastq Sample1.ali.fastq > Sample1.ali.assigned.fastq --DEBUG
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
Traceback (most recent call last):
File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 426, in <module>
primers=readTagfile(options.taglist)
File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 227, in readTagfile
"tag pair %s is already used with primer pairs : (%s,%s)" % (str(tags),forward,reverse)
AssertionError: tag pair (None, None) is already used with primer pairs : (D: gggcaatcctgagccaa,R: ccattgagtctctgcacctatc)```
As barcodes had been removed in the original sequence processing and reads were already demultiplexed, `ngsfilter` was run with `-:-` in the mapping file in place of the barcode tag sequence. Mapping file example has been attached.
[allmap_obi_trnl_trial_troubleshooting.txt](/uploads/99c943a034647ad10a2616b746b9a338/allmap_obi_trnl_trial_troubleshooting.txt)
Does anyone have a similar problem or suggestion?Hello!
I am using OBITools to do a diet analysis for my fecal samples. I am running into an error when using the ngsfilter function:
`(OBITools-1.2.13) ngsfilter -t /allmap_obi_trnl_trial_troubleshooting.txt -u unidentified.fastq Sample1.ali.fastq > Sample1.ali.assigned.fastq`
This is the output when we used the flag `--DEBUG`.
```Traceback (most recent call last):
File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 426, in <module>
primers=readTagfile(options.taglist)
File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 227, in readTagfile
"tag pair %s is already used with primer pairs : (%s,%s)" % (str(tags),forward,reverse)
AssertionError: tag pair (None, None) is already used with primer pairs : (D: gggcaatcctgagccaa,R: ccattgagtctctgcacctatc)
(OBITools-1.2.13) ngsfilter -t /allmap_obi_trnl_trial_troubleshooting.txt -u unidentified.fastq Sample1.ali.fastq > Sample1.ali.assigned.fastq --DEBUG
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
gggcaatcctgagccaa : 17 * 4.0 + 2 * -2.0 = 56.0
ccattgagtctctgcacctatc : 22 * 4.0 + 2 * -2.0 = 76.0
Traceback (most recent call last):
File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 426, in <module>
primers=readTagfile(options.taglist)
File "/Users/username/Documents/trial/OBITools-1.2.13/export/bin/ngsfilter", line 227, in readTagfile
"tag pair %s is already used with primer pairs : (%s,%s)" % (str(tags),forward,reverse)
AssertionError: tag pair (None, None) is already used with primer pairs : (D: gggcaatcctgagccaa,R: ccattgagtctctgcacctatc)```
As barcodes had been removed in the original sequence processing and reads were already demultiplexed, `ngsfilter` was run with `-:-` in the mapping file in place of the barcode tag sequence. Mapping file example has been attached.
[allmap_obi_trnl_trial_troubleshooting.txt](/uploads/99c943a034647ad10a2616b746b9a338/allmap_obi_trnl_trial_troubleshooting.txt)
Does anyone have a similar problem or suggestion?https://git.metabarcoding.org/obitools/obitools/-/issues/46ngsfilter: AssertionError2022-11-01T09:19:27ZChristina Pngsfilter: AssertionErrorHello,
I am trying to use ngsfilter and I get this error
`Traceback (most recent call last):
File "/mnt/big/Metagenomics/OBITools-1.2.0/bin/ngsfilter", line 426, in <module>
primers=readTagfile(options.taglist)
File "/mnt/big/Metagenomics/OBITools-1.2.0/bin/ngsfilter", line 249, in readTagfile
"partial fragment are not usable with primer pair : (%s,%s)" % (forward,reverse)
AssertionError: partial fragment are not usable with primer pair : (D: nnnncgctcttatggtgcatggccgttcttagt,R: nnnnatacagcgcatctaagggcatcacagacc)
`
I am using OBITools-1.2.0/ and a command that I have previously used with a different set of samples and a different sample description fileHello,
I am trying to use ngsfilter and I get this error
`Traceback (most recent call last):
File "/mnt/big/Metagenomics/OBITools-1.2.0/bin/ngsfilter", line 426, in <module>
primers=readTagfile(options.taglist)
File "/mnt/big/Metagenomics/OBITools-1.2.0/bin/ngsfilter", line 249, in readTagfile
"partial fragment are not usable with primer pair : (%s,%s)" % (forward,reverse)
AssertionError: partial fragment are not usable with primer pair : (D: nnnncgctcttatggtgcatggccgttcttagt,R: nnnnatacagcgcatctaagggcatcacagacc)
`
I am using OBITools-1.2.0/ and a command that I have previously used with a different set of samples and a different sample description filehttps://git.metabarcoding.org/obitools/obitools/-/issues/45Please port to Python32019-08-21T19:43:54ZAndreas TillePlease port to Python3Hello,
the Debian Med team is maintaining OBITools for official Debian. The recently released Debian 10 was the last Debian release featuring Python2 since this programming language is EOL. If you are interested that we continue to maintain OBITools in official Debian (and that users of other modern distributions will have no problems to install OBITools on their systems) I'd recommend you port your code to Python3. The 2to3 tool might be of great help here.
Kind regards, Andreas.Hello,
the Debian Med team is maintaining OBITools for official Debian. The recently released Debian 10 was the last Debian release featuring Python2 since this programming language is EOL. If you are interested that we continue to maintain OBITools in official Debian (and that users of other modern distributions will have no problems to install OBITools on their systems) I'd recommend you port your code to Python3. The 2to3 tool might be of great help here.
Kind regards, Andreas.https://git.metabarcoding.org/obitools/obitools/-/issues/15SILVA reference database parsing2017-09-29T05:28:39ZCeline MercierSILVA reference database parsingSomeone would be interested in having `obiaddtaxids` parse SILVA reference databases (it used to be able to do it but the format probably changed). I'm not sure if there are several SILVA formats or only this one:
```
>AAAA02038008.4342.6342 Eukaryota;Opisthokonta;Holozoa;Metazoa (Animalia);Eumetazoa;Bilateria;Arthropoda;Hexapoda;Insecta;Pterygota;Neoptera;Diptera;Oryza sativa Indica Group
UCUGGUUGAUCCUGCCAGUAGUU.......
>AAAB01001705.32.640 Eukaryota;Opisthokonta;Holozoa;Metazoa (Animalia);Eumetazoa;Bilateria;Arthropoda;Hexapoda;Insecta;Pterygota;Neoptera;Diptera;Anopheles gambiae str. PEST
UGAUAUACGCUCGUCUCAAAGGU.....
```
Should I write a parser for that format in `obiaddtaxids`?Someone would be interested in having `obiaddtaxids` parse SILVA reference databases (it used to be able to do it but the format probably changed). I'm not sure if there are several SILVA formats or only this one:
```
>AAAA02038008.4342.6342 Eukaryota;Opisthokonta;Holozoa;Metazoa (Animalia);Eumetazoa;Bilateria;Arthropoda;Hexapoda;Insecta;Pterygota;Neoptera;Diptera;Oryza sativa Indica Group
UCUGGUUGAUCCUGCCAGUAGUU.......
>AAAB01001705.32.640 Eukaryota;Opisthokonta;Holozoa;Metazoa (Animalia);Eumetazoa;Bilateria;Arthropoda;Hexapoda;Insecta;Pterygota;Neoptera;Diptera;Anopheles gambiae str. PEST
UGAUAUACGCUCGUCUCAAAGGU.....
```
Should I write a parser for that format in `obiaddtaxids`?https://git.metabarcoding.org/obitools/obitools/-/issues/87ngsfilter: no tag means no sample identified?2024-02-29T07:19:30ZXiaomeng Qingsfilter: no tag means no sample identified?Hi,
I'm trying to use ngsfilter to de-multiplex my sequences, but I don't have any tags, just different primers for different samples/amplicons. When I use '--no-tags', my primers can be identified but there's no 'sample' attribute at all. If I don't use '--no-tags' then all my sequences are unidentified. So is there a way to demultiplex using just primers not tags?
The command I used:
obi ngsfilter -t obiRL1/ngsfile -u obiRL1/unidentified_sequences --no-tags -e 1 obiRL1/good_sequences obiRL1/identified_sequences
My ngsfilter file:
Dookie 1 -:- TCTGATHTGGATHTAYG ACRTTRCCRGGHGCYT F @
Dookie 2 -:- GCTTTCCCACGAATAAAT ATRAARTTTACWGCT F @
Dookie 3 -:- TTCGGBGARTCVG TTCTCBGANGTCATRTG F @
Dookie 4 -:- GTGGAYGCBAARACVA TTCCCATBAGDATRT F @
Dookie 5 -:- GCCTGYGARATHCAR GCRAABACCATVACG F @
Any comments are welcomed, thank you!Hi,
I'm trying to use ngsfilter to de-multiplex my sequences, but I don't have any tags, just different primers for different samples/amplicons. When I use '--no-tags', my primers can be identified but there's no 'sample' attribute at all. If I don't use '--no-tags' then all my sequences are unidentified. So is there a way to demultiplex using just primers not tags?
The command I used:
obi ngsfilter -t obiRL1/ngsfile -u obiRL1/unidentified_sequences --no-tags -e 1 obiRL1/good_sequences obiRL1/identified_sequences
My ngsfilter file:
Dookie 1 -:- TCTGATHTGGATHTAYG ACRTTRCCRGGHGCYT F @
Dookie 2 -:- GCTTTCCCACGAATAAAT ATRAARTTTACWGCT F @
Dookie 3 -:- TTCGGBGARTCVG TTCTCBGANGTCATRTG F @
Dookie 4 -:- GTGGAYGCBAARACVA TTCCCATBAGDATRT F @
Dookie 5 -:- GCCTGYGARATHCAR GCRAABACCATVACG F @
Any comments are welcomed, thank you!https://git.metabarcoding.org/obitools/obitools/-/issues/86Innovation Education: Evaluating Design Thinking And Problem-Solving2023-12-27T17:45:25ZDo My Online ExamsInnovation Education: Evaluating Design Thinking And Problem-SolvingDesign thinking and problem-solving are the main foci of innovation education. Exams that measure these capabilities must use special assessment techniques. Do evaluations measuring creative thinking and solution-focused methods help students demonstrate problem-solving and design-thinking skills using [do my online exam](https://domyonlineexams.com/) services? These services guarantee that evaluations accurately represent the practical components of innovation education by offering help.Design thinking and problem-solving are the main foci of innovation education. Exams that measure these capabilities must use special assessment techniques. Do evaluations measuring creative thinking and solution-focused methods help students demonstrate problem-solving and design-thinking skills using [do my online exam](https://domyonlineexams.com/) services? These services guarantee that evaluations accurately represent the practical components of innovation education by offering help.https://git.metabarcoding.org/obitools/obitools/-/issues/85OBITools problem with obiclean2023-09-12T13:21:10ZElise SivaultOBITools problem with obicleanHello!
I've been following the OBITools (1.01) wolves diet tutorial for my dataset on vampire bats and successfully reached this step:
obiclean -s merged_sample -r 0.05 -H \ wolf.ali.assigned.uniq.c10.l80.fasta > wolf.ali.assigned.uniq.c10.l80.clean.fasta
Replacing with my file: obiclean -s merged_sample -r 0.05 -H \ bats.cat.ali.assigned.uniq.c2.L150.l30.fasta > bats.clean.fasta
The bats.clean.fasta file is created but remained empty, even after running this command for 5 days!! I changed the value (0.05) many times; from 0.02 to 1
Did you face a similar problem before? My file: bats.cat.ali.assigned.uniq.c2.L150.l30.fasta looks highly similar to the wolves' tutorial one.
Thank you!!Hello!
I've been following the OBITools (1.01) wolves diet tutorial for my dataset on vampire bats and successfully reached this step:
obiclean -s merged_sample -r 0.05 -H \ wolf.ali.assigned.uniq.c10.l80.fasta > wolf.ali.assigned.uniq.c10.l80.clean.fasta
Replacing with my file: obiclean -s merged_sample -r 0.05 -H \ bats.cat.ali.assigned.uniq.c2.L150.l30.fasta > bats.clean.fasta
The bats.clean.fasta file is created but remained empty, even after running this command for 5 days!! I changed the value (0.05) many times; from 0.02 to 1
Did you face a similar problem before? My file: bats.cat.ali.assigned.uniq.c2.L150.l30.fasta looks highly similar to the wolves' tutorial one.
Thank you!!https://git.metabarcoding.org/obitools/obitools/-/issues/63Explore tips for how to borrow money from the cash app:2022-11-03T04:09:53Zkevin AndrewExplore tips for how to borrow money from the cash app:Usually, cash app users should take a look at the tips that may allow them to realizable about [**how to borrow money from cash app**](https://www.contactcustomerservice.co/blog/how-to-borrow-money-on-cash-app/). users may initiate with opening the cash app on their device and choose the banking option. However, sometimes they might have to face troubles due to lack of knowledge, but they can also take the help of the cash app support team for a quick solution.Usually, cash app users should take a look at the tips that may allow them to realizable about [**how to borrow money from cash app**](https://www.contactcustomerservice.co/blog/how-to-borrow-money-on-cash-app/). users may initiate with opening the cash app on their device and choose the banking option. However, sometimes they might have to face troubles due to lack of knowledge, but they can also take the help of the cash app support team for a quick solution.https://git.metabarcoding.org/obitools/obitools/-/issues/62Problem in making database for metabarcoding analysis2021-03-14T17:17:27Zsaeed mohamadzadeProblem in making database for metabarcoding analysisHi all,
I'm new to the OBITools and I'm trying to make database for rbcL (Chloroplast) gene. I've downloaded all plants genome using
wget ftp://ftp.ncbi.nlm.nih.gov/genbank/gbpln*seq.gz
and downloaded the taxonomy from NCBI using
wget ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz and tar -zxvf taxdump.tar.gz
here is the result:
saeedmn@saeed-MN:~/nesteco/TOXO$ ls
citations.dmp division.dmp gencode.dmp names.dmp readme.txt
delnodes.dmp gc.prt merged.dmp nodes.dmp taxdmp_2021-03-01.zip
When I try to convert using
obiconvert --genbank -t ../TAXO --ecopcrdb-output=ncbi_last ../NCBI/*.seq.gz
I faced the following error:
(base) saeedmn@saeed-MN:~/nesteco/TOXO$ obiconvert --genbank -t ../TAXO --ecopcrdb-output=rbcl_last ../NCBI/*.seq.gz
[Errno 2] No such file or directory: '../TAXO/nodes.dmp'
Exception ignored in: <function EcoPCRDBSequenceWriter.__del__ at 0x7f2e2f489310>
Traceback (most recent call last):
File "/usr/lib/python3/dist-packages/obitools/ecopcr/sequence.py", line 180, in __del__
self.close()
File "/usr/lib/python3/dist-packages/obitools/ecopcr/sequence.py", line 149, in close
self._file.seek(0,0)
AttributeError: 'EcoPCRDBSequenceWriter' object has no attribute '_file'
Can anyone suggest how I can overcome this error? Thanks in advance.Hi all,
I'm new to the OBITools and I'm trying to make database for rbcL (Chloroplast) gene. I've downloaded all plants genome using
wget ftp://ftp.ncbi.nlm.nih.gov/genbank/gbpln*seq.gz
and downloaded the taxonomy from NCBI using
wget ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz and tar -zxvf taxdump.tar.gz
here is the result:
saeedmn@saeed-MN:~/nesteco/TOXO$ ls
citations.dmp division.dmp gencode.dmp names.dmp readme.txt
delnodes.dmp gc.prt merged.dmp nodes.dmp taxdmp_2021-03-01.zip
When I try to convert using
obiconvert --genbank -t ../TAXO --ecopcrdb-output=ncbi_last ../NCBI/*.seq.gz
I faced the following error:
(base) saeedmn@saeed-MN:~/nesteco/TOXO$ obiconvert --genbank -t ../TAXO --ecopcrdb-output=rbcl_last ../NCBI/*.seq.gz
[Errno 2] No such file or directory: '../TAXO/nodes.dmp'
Exception ignored in: <function EcoPCRDBSequenceWriter.__del__ at 0x7f2e2f489310>
Traceback (most recent call last):
File "/usr/lib/python3/dist-packages/obitools/ecopcr/sequence.py", line 180, in __del__
self.close()
File "/usr/lib/python3/dist-packages/obitools/ecopcr/sequence.py", line 149, in close
self._file.seek(0,0)
AttributeError: 'EcoPCRDBSequenceWriter' object has no attribute '_file'
Can anyone suggest how I can overcome this error? Thanks in advance.https://git.metabarcoding.org/obitools/obitools/-/issues/60Trouble installing OBITools2023-08-09T17:05:11ZAmalia MailliTrouble installing OBIToolsHello,
I have been having issues installing OBITools. More specifically, after initiating the get-obitools,py command, I get this error message:
` Successfully downloaded OBITools
Cleaning up...
Installing OBITools (1.2.13) in serenity mode
Look for package virtualenv (>=1.11.0) : ok version 20.3.1 installed
Traceback (most recent call last):
File "setup.py", line 37, in <module>
serenity=serenity_mode(PACKAGE,VERSION)
File "distutils.ext/obidistutils/serenity/__init__.py", line 109, in serenity_mode
serenity_snake(args.virtual,package,version)
File "distutils.ext/obidistutils/serenity/__init__.py", line 58, in serenity_snake
virtualpython=serenity_virtualenv(envname,package,version,minversion=minversion)
File "distutils.ext/obidistutils/serenity/virtual.py", line 125, in serenity_virtualenv
virtualenv.create_environment(envname)
AttributeError: 'module' object has no attribute 'create_environment'
Traceback (most recent call last):
File "get-obitools.py", line 45234, in <module>
main()
File "get-obitools.py", line 45196, in main
envactivate = open(os.path.join(virtualenvname,'bin','activate')).readlines()
IOError: [Errno 2] No such file or directory: '/home/genomics/ama/software/obitools/OBITools-1.2.13/bin/activate'`
There is an OBITools program installed but when I try to activate it I get the same error message:
`You can now use OBITools
/usr/bin/bash: /home/genomics/ama/software/obitools/OBITools-1.2.13/bin/activate: No such file or directory`
The whole issue is similar to what has been discussed in this thread>
https://git.metabarcoding.org/obitools/obitools/issues/25#
I tried the command suggested by Eric but it does not seem to work and I cannot find any more information on how to solve this online.
Can someone please help me with this issue?
Thank you in advance.
Best,
AmaliaHello,
I have been having issues installing OBITools. More specifically, after initiating the get-obitools,py command, I get this error message:
` Successfully downloaded OBITools
Cleaning up...
Installing OBITools (1.2.13) in serenity mode
Look for package virtualenv (>=1.11.0) : ok version 20.3.1 installed
Traceback (most recent call last):
File "setup.py", line 37, in <module>
serenity=serenity_mode(PACKAGE,VERSION)
File "distutils.ext/obidistutils/serenity/__init__.py", line 109, in serenity_mode
serenity_snake(args.virtual,package,version)
File "distutils.ext/obidistutils/serenity/__init__.py", line 58, in serenity_snake
virtualpython=serenity_virtualenv(envname,package,version,minversion=minversion)
File "distutils.ext/obidistutils/serenity/virtual.py", line 125, in serenity_virtualenv
virtualenv.create_environment(envname)
AttributeError: 'module' object has no attribute 'create_environment'
Traceback (most recent call last):
File "get-obitools.py", line 45234, in <module>
main()
File "get-obitools.py", line 45196, in main
envactivate = open(os.path.join(virtualenvname,'bin','activate')).readlines()
IOError: [Errno 2] No such file or directory: '/home/genomics/ama/software/obitools/OBITools-1.2.13/bin/activate'`
There is an OBITools program installed but when I try to activate it I get the same error message:
`You can now use OBITools
/usr/bin/bash: /home/genomics/ama/software/obitools/OBITools-1.2.13/bin/activate: No such file or directory`
The whole issue is similar to what has been discussed in this thread>
https://git.metabarcoding.org/obitools/obitools/issues/25#
I tried the command suggested by Eric but it does not seem to work and I cannot find any more information on how to solve this online.
Can someone please help me with this issue?
Thank you in advance.
Best,
Amaliahttps://git.metabarcoding.org/obitools/obitools/-/issues/59obistat -s seq_length -v seq_length not working2020-11-27T08:39:15Zpeter_ssssobistat -s seq_length -v seq_length not workingHi,
maximum/mean/minimum of a regular fasta file work fine, but I don't get to stddev/var.
Below is the output.
thanks!
> obistat -s seq_length test.fasta
test.fasta 76.8 % |######################################\ ] remain : 00:00:00
sd_seq_length count total
Traceback (most recent call last):
File "/software/packages-15.1/obitools/1.2.13/bin/obistat", line 217, in <module>
print (("%%%df" % lsigma[m]) % sigma[m][c])+"\t",
KeyError: 'seq_length'
> obistat -v seq_length test.fasta
test.fasta 76.8 % |######################################\ ] remain : 00:00:00
var_seq_length count total
Traceback (most recent call last):
File "/software/packages-15.1/obitools/1.2.13/bin/obistat", line 215, in <module>
print (("%%%df" % lvarp[m]) % varp[m][c])+"\t",
KeyError: 'seq_length'Hi,
maximum/mean/minimum of a regular fasta file work fine, but I don't get to stddev/var.
Below is the output.
thanks!
> obistat -s seq_length test.fasta
test.fasta 76.8 % |######################################\ ] remain : 00:00:00
sd_seq_length count total
Traceback (most recent call last):
File "/software/packages-15.1/obitools/1.2.13/bin/obistat", line 217, in <module>
print (("%%%df" % lsigma[m]) % sigma[m][c])+"\t",
KeyError: 'seq_length'
> obistat -v seq_length test.fasta
test.fasta 76.8 % |######################################\ ] remain : 00:00:00
var_seq_length count total
Traceback (most recent call last):
File "/software/packages-15.1/obitools/1.2.13/bin/obistat", line 215, in <module>
print (("%%%df" % lvarp[m]) % varp[m][c])+"\t",
KeyError: 'seq_length'https://git.metabarcoding.org/obitools/obitools/-/issues/58obipr2 not working2020-11-06T08:59:22ZDani Díaz de Quijanoobipr2 not workingHi all!
I need to convert PR2 database to ecoPCR format. I made a dir called PR2Dir and ran this command from its parent folder, following obipr2 instructions:
`obipr2`
It didn't work:
```
Traceback (most recent call last):
File "/Users/daniquijano/miniconda3/bin/obipr2", line 271, in <module>
sequrl,taxurl,options.ecopcroutput = pr2URLS(options)
File "/Users/daniquijano/miniconda3/bin/obipr2", line 101, in pr2URLS
archive=getHyperlink(baseurl)
File "/Users/daniquijano/miniconda3/bin/obipr2", line 75, in getHyperlink
furl = urllib2.urlopen(url)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 154, in urlopen
return opener.open(url, data, timeout)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 429, in open
response = self._open(req, data)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 447, in _open
'_open', req)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 407, in _call_chain
result = func(*args)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 1228, in http_open
return self.do_open(httplib.HTTPConnection, req)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 1198, in do_open
raise URLError(err)
urllib2.URLError: <urlopen error [Errno 60] Operation timed out>
```
In fact, the obipr2 instructions state that the above mentioned command would download the database from a deprecated version of PR2 website: http://ssu-rrna.org/pr2/
Therefore, I tried to directly download it from the new website (https://pr2-database.org/documentation/pr2-files/) and use obipr2 locally. I tried all the possible combinations with these 2 commands:
`obipr2 --local=PR2Dir`
And:
`obipr2 --localdb=PR2Dir`
And all the possible formats of PR2 database downloadable from the mentioned web site (two file format for Mothur and QIIME, dada2 format, UTAX format for USEARCH and VSEARCH, and taxo_long for BLAST). I tried placing these files either in the PRDir2 folder or in its parent folder. In all the mentioned combinations I got this error:
```
File "/Users/daniquijano/miniconda3/bin/obipr2", line 271, in <module>
sequrl,taxurl,options.ecopcroutput = pr2URLS(options)
File "/Users/daniquijano/miniconda3/bin/obipr2", line 111, in pr2URLS
latest = max(versions)
ValueError: max() arg is an empty sequence
```
Is there a way to fix or bypass that? Maybe using a particular format from the ones available at PR2, then editing it (using sed, obiannotate and others??) and finally using obiconvert to turn fasta file into ecoPCR database? But how should the fasta file that was to be converted to ecoPCR database look like?
Thank you for your attention!Hi all!
I need to convert PR2 database to ecoPCR format. I made a dir called PR2Dir and ran this command from its parent folder, following obipr2 instructions:
`obipr2`
It didn't work:
```
Traceback (most recent call last):
File "/Users/daniquijano/miniconda3/bin/obipr2", line 271, in <module>
sequrl,taxurl,options.ecopcroutput = pr2URLS(options)
File "/Users/daniquijano/miniconda3/bin/obipr2", line 101, in pr2URLS
archive=getHyperlink(baseurl)
File "/Users/daniquijano/miniconda3/bin/obipr2", line 75, in getHyperlink
furl = urllib2.urlopen(url)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 154, in urlopen
return opener.open(url, data, timeout)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 429, in open
response = self._open(req, data)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 447, in _open
'_open', req)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 407, in _call_chain
result = func(*args)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 1228, in http_open
return self.do_open(httplib.HTTPConnection, req)
File "/Users/daniquijano/miniconda3/lib/python2.7/urllib2.py", line 1198, in do_open
raise URLError(err)
urllib2.URLError: <urlopen error [Errno 60] Operation timed out>
```
In fact, the obipr2 instructions state that the above mentioned command would download the database from a deprecated version of PR2 website: http://ssu-rrna.org/pr2/
Therefore, I tried to directly download it from the new website (https://pr2-database.org/documentation/pr2-files/) and use obipr2 locally. I tried all the possible combinations with these 2 commands:
`obipr2 --local=PR2Dir`
And:
`obipr2 --localdb=PR2Dir`
And all the possible formats of PR2 database downloadable from the mentioned web site (two file format for Mothur and QIIME, dada2 format, UTAX format for USEARCH and VSEARCH, and taxo_long for BLAST). I tried placing these files either in the PRDir2 folder or in its parent folder. In all the mentioned combinations I got this error:
```
File "/Users/daniquijano/miniconda3/bin/obipr2", line 271, in <module>
sequrl,taxurl,options.ecopcroutput = pr2URLS(options)
File "/Users/daniquijano/miniconda3/bin/obipr2", line 111, in pr2URLS
latest = max(versions)
ValueError: max() arg is an empty sequence
```
Is there a way to fix or bypass that? Maybe using a particular format from the ones available at PR2, then editing it (using sed, obiannotate and others??) and finally using obiconvert to turn fasta file into ecoPCR database? But how should the fasta file that was to be converted to ecoPCR database look like?
Thank you for your attention!https://git.metabarcoding.org/obitools/obitools/-/issues/57AttributeError: 'itertools.chain' object has no attribute 'next'2022-11-01T07:44:24ZCré lAttributeError: 'itertools.chain' object has no attribute 'next'Hello,
I hope you are fine :) I'm writing in english for people who meet the same issue.
I have installed the obitools, but, when I want to use the first function obicount, I have this error message that i don't understand :
cre@cre-Latitude-E6230:~$ obicount /home/cre/OBITools-1.2.13/bin/activate/fastq_files/180427_SN1126_A_L001_GWM-1359_R1.fastq
Traceback (most recent call last):
File "/usr/bin/obicount", line 46, in <module>
for s in entries:
File "src/obitools/options/_options.pyx", line 105, in allEntryIterator
File "src/obitools/fastq/_fastq.pyx", line 480, in fastFastqIterator
AttributeError: 'itertools.chain' object has no attribute 'next'
I understand that File.... are exceptions, but what is the problem with the itertools.chain and how can I fix it ?
Best regards
Have a nice day
CrescienseHello,
I hope you are fine :) I'm writing in english for people who meet the same issue.
I have installed the obitools, but, when I want to use the first function obicount, I have this error message that i don't understand :
cre@cre-Latitude-E6230:~$ obicount /home/cre/OBITools-1.2.13/bin/activate/fastq_files/180427_SN1126_A_L001_GWM-1359_R1.fastq
Traceback (most recent call last):
File "/usr/bin/obicount", line 46, in <module>
for s in entries:
File "src/obitools/options/_options.pyx", line 105, in allEntryIterator
File "src/obitools/fastq/_fastq.pyx", line 480, in fastFastqIterator
AttributeError: 'itertools.chain' object has no attribute 'next'
I understand that File.... are exceptions, but what is the problem with the itertools.chain and how can I fix it ?
Best regards
Have a nice day
Cresciensehttps://git.metabarcoding.org/obitools/obitools/-/issues/56Using Genbank databases for ecoPCR2020-09-04T13:26:02ZRasit BilginUsing Genbank databases for ecoPCRHi,
In the wolf tutorial, we build a reference database for ecoPCR using the EMBL database. Is there a way to do the same with GenBank database, and if yes, do you know how we could format the necessary databases from GenBank (would you be able to suggest links)? I'v been using Obitools 1 and following the wolf tutorial. Thanks, best wishes.Hi,
In the wolf tutorial, we build a reference database for ecoPCR using the EMBL database. Is there a way to do the same with GenBank database, and if yes, do you know how we could format the necessary databases from GenBank (would you be able to suggest links)? I'v been using Obitools 1 and following the wolf tutorial. Thanks, best wishes.https://git.metabarcoding.org/obitools/obitools/-/issues/55asymmetry in simpleLCS()2020-05-04T00:22:37ZLara Urbanasymmetry in simpleLCS()Dear OBItools team,
I tried to understand how OBItools ECOTAG exactly finds the best matching hit, i.e how it determines the longest common substring (LCS) and the shortest alignment corresponding to this LCS.
I think that I found most of the source code here: https://git.metabarcoding.org/obitools/obitools/tree/master/src; if I compare two identical sequences with 'simpleLCS' (in src/obitools/align/_lcs.ext.1.c) and a base pair is added to the beginning of one of the sequences, this is evaluated as mismatch (i.e. LCS is reduced by one), whereas a base pair added to the end of a sequence is just being ignored (i.e. LCS stays the same). There seems to be an issue with symmetry; e.g. if:
s1 = 'acccctttgcccatatcggccctagctctc'
s2 = 'acccctttgcccatatcggccctagctct'
s3 = 'cccctttgcccatatcggccctagctctc'
then: simpleLCS(s1,s1), simpleLCS(s1,s2), simpleLCS(s2,s1), and simpleLCS(s1,s3) deliver the same values, but not simpleLCS(s3,s1).
Could you help me understand this, please?
Best regards,
LaraDear OBItools team,
I tried to understand how OBItools ECOTAG exactly finds the best matching hit, i.e how it determines the longest common substring (LCS) and the shortest alignment corresponding to this LCS.
I think that I found most of the source code here: https://git.metabarcoding.org/obitools/obitools/tree/master/src; if I compare two identical sequences with 'simpleLCS' (in src/obitools/align/_lcs.ext.1.c) and a base pair is added to the beginning of one of the sequences, this is evaluated as mismatch (i.e. LCS is reduced by one), whereas a base pair added to the end of a sequence is just being ignored (i.e. LCS stays the same). There seems to be an issue with symmetry; e.g. if:
s1 = 'acccctttgcccatatcggccctagctctc'
s2 = 'acccctttgcccatatcggccctagctct'
s3 = 'cccctttgcccatatcggccctagctctc'
then: simpleLCS(s1,s1), simpleLCS(s1,s2), simpleLCS(s2,s1), and simpleLCS(s1,s3) deliver the same values, but not simpleLCS(s3,s1).
Could you help me understand this, please?
Best regards,
Larahttps://git.metabarcoding.org/obitools/obitools/-/issues/54ecotag blocked2020-03-18T23:20:23ZLuca Turoloecotag blockedHello
I ran ecotag and i don't know why it stopped to work after the 16.5% with a printed cache size. Here the code:
ecotag -t /home/lt/TAXO/ -R TRNL\ DATABASE/renl_db.fasta Plate_9_uniq_c10_l80_
clean.fasta > Plate_9_tag.fasta
Here the result:
Reading taxonomy dump file...
List all taxonomy rank...
Indexing taxonomy...
Indexing parent and rank...
Adding scientific name...
Adding taxid alias...
Adding deleted taxid...
Reading reference DB ... : 19083
Cache size : 1000000
Plate_9_uniq_c10_l80_clean.fasta 16.5 % |########- ] remain : 00:01:34
Thanks in advance.
Luca TuroloHello
I ran ecotag and i don't know why it stopped to work after the 16.5% with a printed cache size. Here the code:
ecotag -t /home/lt/TAXO/ -R TRNL\ DATABASE/renl_db.fasta Plate_9_uniq_c10_l80_
clean.fasta > Plate_9_tag.fasta
Here the result:
Reading taxonomy dump file...
List all taxonomy rank...
Indexing taxonomy...
Indexing parent and rank...
Adding scientific name...
Adding taxid alias...
Adding deleted taxid...
Reading reference DB ... : 19083
Cache size : 1000000
Plate_9_uniq_c10_l80_clean.fasta 16.5 % |########- ] remain : 00:01:34
Thanks in advance.
Luca Turolohttps://git.metabarcoding.org/obitools/obitools/-/issues/47obisilva not working2019-09-12T02:40:34ZChristina Tobisilva not workingHi,
I have been using obitools for my analysis of 16S metabarcoding data. Just trying to create an ecoPCR database from the SILVA SSU database, prior to taxonomic assignment.
As per the manual, I have tried the following:
```
obisilva --ssu --parc --local=/home/silva_db
```
the folder silva_db contains:
```
SILVA_132_SSUParc_tax_silva.fasta
/taxonomy/tax_slv_ssu_132.txt
```
this executes fine and the progress bar shows 100% and I get the following output files:
```
-rw-rw---- 1 user user 2814245955 Sep 2 13:08 silva_132_ssuparc_full_001.sdx
-rw-rw---- 1 user user 162328 Sep 2 12:53 silva_132_ssuparc_full.adx
-rw-rw---- 1 user user 256770210 Sep 2 13:08 silva_132_ssuparc_full.ldx
-rw-rw---- 1 user user 637224 Sep 2 12:53 silva_132_ssuparc_full.ndx
-rw-rw---- 1 user user 296 Sep 2 12:53 silva_132_ssuparc_full.rdx
-rw-rw---- 1 user user 434319 Sep 2 12:53 silva_132_ssuparc_full.tdx
```
But it doesn't create a pdx file, which it looks for later on when using
```
ecotag -d silva_132_ssuparc_full -R SILVA_132_SSUParc_tax_silva.fasta input.fasta > output.fasta
```
```
Error message:
Reading binary taxonomy database...
[INFO : Taxon alias file found]
[INFO : Local taxon file found] : 6073181 added taxa
Taxonomical tree read
[Errno 2] No such file or directory: 'silva_132_ssuparc_full.pdx'
[INFO : Preferred taxon name file not found]
ok
Reading reference DB ... : 6073181
Traceback (most recent call last):
File "/usr/bin/ecotag", line 346, in <module>
taxonlink[seqid]=int(seq['taxid'])
File "src/obitools/_obitools.pyx", line 263, in obitools._obitools.BioSequence.__getitem__
File "src/obitools/_obitools.pyx", line 217, in obitools._obitools.BioSequence.getKey
KeyError: 'taxid'
```
I have also tried
```
obisilva --ssu --parc
```
where it is supposed to download the database and create the indexing files, but the progress bar stopped at 68% and didn't continue the job at all, it just stalled and it resulted in the same set of output files as mentioned above. Plus, it didn't download the fasta file, which you need later on.
Any help, would be much appreciated, thanks!Hi,
I have been using obitools for my analysis of 16S metabarcoding data. Just trying to create an ecoPCR database from the SILVA SSU database, prior to taxonomic assignment.
As per the manual, I have tried the following:
```
obisilva --ssu --parc --local=/home/silva_db
```
the folder silva_db contains:
```
SILVA_132_SSUParc_tax_silva.fasta
/taxonomy/tax_slv_ssu_132.txt
```
this executes fine and the progress bar shows 100% and I get the following output files:
```
-rw-rw---- 1 user user 2814245955 Sep 2 13:08 silva_132_ssuparc_full_001.sdx
-rw-rw---- 1 user user 162328 Sep 2 12:53 silva_132_ssuparc_full.adx
-rw-rw---- 1 user user 256770210 Sep 2 13:08 silva_132_ssuparc_full.ldx
-rw-rw---- 1 user user 637224 Sep 2 12:53 silva_132_ssuparc_full.ndx
-rw-rw---- 1 user user 296 Sep 2 12:53 silva_132_ssuparc_full.rdx
-rw-rw---- 1 user user 434319 Sep 2 12:53 silva_132_ssuparc_full.tdx
```
But it doesn't create a pdx file, which it looks for later on when using
```
ecotag -d silva_132_ssuparc_full -R SILVA_132_SSUParc_tax_silva.fasta input.fasta > output.fasta
```
```
Error message:
Reading binary taxonomy database...
[INFO : Taxon alias file found]
[INFO : Local taxon file found] : 6073181 added taxa
Taxonomical tree read
[Errno 2] No such file or directory: 'silva_132_ssuparc_full.pdx'
[INFO : Preferred taxon name file not found]
ok
Reading reference DB ... : 6073181
Traceback (most recent call last):
File "/usr/bin/ecotag", line 346, in <module>
taxonlink[seqid]=int(seq['taxid'])
File "src/obitools/_obitools.pyx", line 263, in obitools._obitools.BioSequence.__getitem__
File "src/obitools/_obitools.pyx", line 217, in obitools._obitools.BioSequence.getKey
KeyError: 'taxid'
```
I have also tried
```
obisilva --ssu --parc
```
where it is supposed to download the database and create the indexing files, but the progress bar stopped at 68% and didn't continue the job at all, it just stalled and it resulted in the same set of output files as mentioned above. Plus, it didn't download the fasta file, which you need later on.
Any help, would be much appreciated, thanks!https://git.metabarcoding.org/obitools/obitools/-/issues/44extractread22019-08-06T01:30:52ZEmily Dziedzicextractread2is extractread2 still included in the OBITools package?is extractread2 still included in the OBITools package?https://git.metabarcoding.org/obitools/obitools/-/issues/43ecotag bug with short sequences2019-10-04T05:43:41ZCeline Mercierecotag bug with short sequencesecotag computes erroneous alignment results when the sequences are shorter than 8bp (I think).
It can result in something that looks like an infinite loop with a memory build-up.
Filter short sequences out with obigrep to avoid this problem.ecotag computes erroneous alignment results when the sequences are shorter than 8bp (I think).
It can result in something that looks like an infinite loop with a memory build-up.
Filter short sequences out with obigrep to avoid this problem.https://git.metabarcoding.org/obitools/obitools/-/issues/36obiannotate -C working partially2022-11-03T06:41:34ZLucie Zingerobiannotate -C working partiallyobiannotate -C option seems to work partially when the header contain python dictionaries.
Example of input:
>HISEQ:204:C8E5RANXX:7:1308:3148:82868_CONS_SUB_SUB ali_length=31; seq_ab_match=31; species_name=None; family=46569; class_name=Insecta; phylum_name=Arthropoda; seq_a_deletion=0; rank=subfamily; cluster=HISEQ:204:C8E5RANXX:7:1308:3148:82868_CONS_SUB_SUB; best_identity={'order_filtered_embl_r136_noenv_COL': 0.9030303030303031}; phylum=6656; forward_match=acgctgttatcccttagg; forward_primer=acgctgttatccctwagg; reverse_primer=gacgataagaccctwtaga; species=None; merged_sample={'H20_Cs_r4': 1, 'H20_Cs_r3': 11}; forward_score=72.0; seq_a_mismatch=0; start=taatt; forward_tag=atatagcg; seq_b_mismatch=0; scientific_name=Apicotermitinae; experiment=litiere_colle; species_list={'order_filtered_embl_r136_noenv_COL': ['Anoplotermes group sp. 1 TB-2017', 'Anoplotermes group nr. E1 TB-2014', 'Anoplotermes schwarzi', 'Ruptitermes nr. xanthochiton FG-ND2-26', 'Patawatermes sp. A TB-2017', 'Patawatermes nigripunctatus', 'Aparatermes sp. A TB-2017', 'Patawatermes turricola', 'Anoplotermes banksi', 'Humutermes krishnai', 'Grigiotermes hageni', 'Longustitermes manni']}; seq_a_single=94; cluster_weight=12; reverse_score=76.0; count=12; seq_b_insertion=0; taxid_by_db={'order_filtered_embl_r136_noenv_COL': 92739}; id_status={'order_filtered_embl_r136_noenv_COL': True}; seq_b_deletion=0; genus_name=None; cluster_center=True; seq_a_insertion=0; seq_length_ori=219; reverse_tag=agactatg; class=50557; goodAli=Alignement; match_count={'order_filtered_embl_r136_noenv_COL': 13}; family_name=Termitidae; best_match={'order_filtered_embl_r136_noenv_COL': 'KY224594; order_name=Blattodea; taxid=92739; scientific_name_by_db={'order_filtered_embl_r136_noenv_COL': 'Apicotermitinae'}; cluster_score=1.0; genus=None; order=85823; '}; order_name=Blattodea; rank_by_db={'order_filtered_embl_r136_noenv_COL': 'subfamily'}; seq_length=162; seq_b_single=94; status=full; mode=alignment; position=08_01D; genus=None; order=85823; distance=0.0;
taatttaatcttataatcaaaataaatggatcaaaaaactataaacaaatatatagcagt
aaagaggagttaaataaattcctcccatcgccccaacaaaacacctaaatcacttaataa
aacaaaacaaacaaaataataaaaagtaaataaaatgttaac
command:
obiannotate -C toto.fasta
Example corresponding output:
>HISEQ:204:C8E5RANXX:7:1308:3148:82868_CONS_SUB_SUB '}; order_name=Blattodea; rank_by_db={'order_filtered_embl_r136_noenv_COL': 'subfamily'}; seq_length=162; seq_b_single=94; status=full; mode=alignment; position=08_01D; genus=None; order=85823; distance=0.0;
taatttaatcttataatcaaaataaatggatcaaaaaactataaacaaatatatagcagt
aaagaggagttaaataaattcctcccatcgccccaacaaaacacctaaatcacttaataa
aacaaaacaaacaaaataataaaaagtaaataaaatgttaacobiannotate -C option seems to work partially when the header contain python dictionaries.
Example of input:
>HISEQ:204:C8E5RANXX:7:1308:3148:82868_CONS_SUB_SUB ali_length=31; seq_ab_match=31; species_name=None; family=46569; class_name=Insecta; phylum_name=Arthropoda; seq_a_deletion=0; rank=subfamily; cluster=HISEQ:204:C8E5RANXX:7:1308:3148:82868_CONS_SUB_SUB; best_identity={'order_filtered_embl_r136_noenv_COL': 0.9030303030303031}; phylum=6656; forward_match=acgctgttatcccttagg; forward_primer=acgctgttatccctwagg; reverse_primer=gacgataagaccctwtaga; species=None; merged_sample={'H20_Cs_r4': 1, 'H20_Cs_r3': 11}; forward_score=72.0; seq_a_mismatch=0; start=taatt; forward_tag=atatagcg; seq_b_mismatch=0; scientific_name=Apicotermitinae; experiment=litiere_colle; species_list={'order_filtered_embl_r136_noenv_COL': ['Anoplotermes group sp. 1 TB-2017', 'Anoplotermes group nr. E1 TB-2014', 'Anoplotermes schwarzi', 'Ruptitermes nr. xanthochiton FG-ND2-26', 'Patawatermes sp. A TB-2017', 'Patawatermes nigripunctatus', 'Aparatermes sp. A TB-2017', 'Patawatermes turricola', 'Anoplotermes banksi', 'Humutermes krishnai', 'Grigiotermes hageni', 'Longustitermes manni']}; seq_a_single=94; cluster_weight=12; reverse_score=76.0; count=12; seq_b_insertion=0; taxid_by_db={'order_filtered_embl_r136_noenv_COL': 92739}; id_status={'order_filtered_embl_r136_noenv_COL': True}; seq_b_deletion=0; genus_name=None; cluster_center=True; seq_a_insertion=0; seq_length_ori=219; reverse_tag=agactatg; class=50557; goodAli=Alignement; match_count={'order_filtered_embl_r136_noenv_COL': 13}; family_name=Termitidae; best_match={'order_filtered_embl_r136_noenv_COL': 'KY224594; order_name=Blattodea; taxid=92739; scientific_name_by_db={'order_filtered_embl_r136_noenv_COL': 'Apicotermitinae'}; cluster_score=1.0; genus=None; order=85823; '}; order_name=Blattodea; rank_by_db={'order_filtered_embl_r136_noenv_COL': 'subfamily'}; seq_length=162; seq_b_single=94; status=full; mode=alignment; position=08_01D; genus=None; order=85823; distance=0.0;
taatttaatcttataatcaaaataaatggatcaaaaaactataaacaaatatatagcagt
aaagaggagttaaataaattcctcccatcgccccaacaaaacacctaaatcacttaataa
aacaaaacaaacaaaataataaaaagtaaataaaatgttaac
command:
obiannotate -C toto.fasta
Example corresponding output:
>HISEQ:204:C8E5RANXX:7:1308:3148:82868_CONS_SUB_SUB '}; order_name=Blattodea; rank_by_db={'order_filtered_embl_r136_noenv_COL': 'subfamily'}; seq_length=162; seq_b_single=94; status=full; mode=alignment; position=08_01D; genus=None; order=85823; distance=0.0;
taatttaatcttataatcaaaataaatggatcaaaaaactataaacaaatatatagcagt
aaagaggagttaaataaattcctcccatcgccccaacaaaacacctaaatcacttaataa
aacaaaacaaacaaaataataaaaagtaaataaaatgttaac