Commit ebe8c0b5 authored by Eric Coissac's avatar Eric Coissac

Initial version of ecoPCR

git-svn-id: https://www.grenoble.prabi.fr/svn/LECASofts/ecoPCR/trunk@5 60f365c0-8329-0410-b2a4-ec073aeeaa1d
parent f3d2273d
r -1acghtgd -2gctcagctagcta /Users/coissac/encours/ecoPCR/tools/ecodb
print put
print out
f ecoPCR
r -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
bt
print label1
up
print label1
print (char*)label1
r -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
bt
up 3
l
b 38
r
r -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
print label
print ranks
print *ranks
print ranks->label +1
print *ranks->label +1
print *(ranks->label +1)
print *(ranks->label +2)
b ecotax.c:147
r -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
print current_taxon ;
print current_taxon
n
print current_taxon ;
print current_taxon
print *current_taxon
print taxonomy->taxons[11]
print taxonomy->taxons[2952]
print taxonomy->taxons->taxon[2952]
print taxonomy->ranks->rank[11]
print taxonomy->ranks->label[11]
print taxonomy->ranks->label[3]
b ecotax.c:147
r -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
print current_taxon
print *current_taxon
n
print *current_taxon
b ecotax.c:147
r -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
n
print *current_taxon
r -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
n
print *current_taxon
b ecodna.c:70
r -1GGGCAATCCTGAGCC#A#A# -2CCATTGAGTCTCTGCACCTA#T#C# -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
*sb
print *sb
print sb
print str
b 52
r -1GGGCAATCCTGAGCC#A#A# -2CCATTGAGTCTCTGCACCTA#T#C# -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
print str
r -1GGGCAATCCTGAGCC#A#A# -2CCATTGAGTCTCTGCACCTA#T#C# -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
bt
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
-include ../makefile.init
RM := rm -rf
# All of the sources participating in the build are defined here
-include sources.mk
-include subdir.mk
-include src/libecoPCR/subdir.mk
-include src/libapat/subdir.mk
-include src/subdir.mk
-include objects.mk
ifneq ($(MAKECMDGOALS),clean)
ifneq ($(strip $(C_DEPS)),)
-include $(C_DEPS)
endif
endif
-include ../makefile.defs
# Add inputs and outputs from these tool invocations to the build variables
# All Target
all: ecoPCR
# Tool invocations
ecoPCR: $(OBJS) $(USER_OBJS)
@echo 'Building target: $@'
@echo 'Invoking: MacOS X C Linker'
gcc -o "ecoPCR" $(OBJS) $(USER_OBJS) $(LIBS)
@echo 'Finished building target: $@'
@echo ' '
# Other Targets
clean:
-$(RM) $(OBJS)$(EXECUTABLES)$(C_DEPS) ecoPCR
-@echo ' '
.PHONY: all clean dependents
.SECONDARY:
-include ../makefile.targets
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
LIBS := -lz
USER_OBJS :=
\ No newline at end of file
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
C_SRCS :=
O_SRCS :=
ASM_SRCS :=
S_SRCS :=
OBJ_SRCS :=
OBJS :=
EXECUTABLES :=
C_DEPS :=
# Every subdirectory with source files must be described here
SUBDIRS := \
src/libecoPCR \
src/libapat \
src \
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
# Add inputs and outputs from these tool invocations to the build variables
C_SRCS += \
../src/libapat/CODES/gendual.c
OBJS += \
./src/libapat/CODES/gendual.o
C_DEPS += \
./src/libapat/CODES/gendual.d
# Each subdirectory must supply rules for building sources it contributes
src/libapat/CODES/%.o: ../src/libapat/CODES/%.c
@echo 'Building file: $<'
@echo 'Invoking: GCC C Compiler'
gcc -DMAC_OS_X -O0 -g3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
@echo 'Finished building: $<'
@echo ' '
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
# Add inputs and outputs from these tool invocations to the build variables
C_SRCS += \
../src/libapat/apat_parse.c \
../src/libapat/apat_search.c \
../src/libapat/libstki.c
OBJS += \
./src/libapat/apat_parse.o \
./src/libapat/apat_search.o \
./src/libapat/libstki.o
C_DEPS += \
./src/libapat/apat_parse.d \
./src/libapat/apat_search.d \
./src/libapat/libstki.d
# Each subdirectory must supply rules for building sources it contributes
src/libapat/%.o: ../src/libapat/%.c
@echo 'Building file: $<'
@echo 'Invoking: GCC C Compiler'
gcc -DMAC_OS_X -O0 -g3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
@echo 'Finished building: $<'
@echo ' '
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
# Add inputs and outputs from these tool invocations to the build variables
C_SRCS += \
../src/libecoPCR/ecoError.c \
../src/libecoPCR/ecoIOUtils.c \
../src/libecoPCR/ecoMalloc.c \
../src/libecoPCR/ecoapat.c \
../src/libecoPCR/ecodna.c \
../src/libecoPCR/ecorank.c \
../src/libecoPCR/ecoseq.c \
../src/libecoPCR/ecotax.c
OBJS += \
./src/libecoPCR/ecoError.o \
./src/libecoPCR/ecoIOUtils.o \
./src/libecoPCR/ecoMalloc.o \
./src/libecoPCR/ecoapat.o \
./src/libecoPCR/ecodna.o \
./src/libecoPCR/ecorank.o \
./src/libecoPCR/ecoseq.o \
./src/libecoPCR/ecotax.o
C_DEPS += \
./src/libecoPCR/ecoError.d \
./src/libecoPCR/ecoIOUtils.d \
./src/libecoPCR/ecoMalloc.d \
./src/libecoPCR/ecoapat.d \
./src/libecoPCR/ecodna.d \
./src/libecoPCR/ecorank.d \
./src/libecoPCR/ecoseq.d \
./src/libecoPCR/ecotax.d
# Each subdirectory must supply rules for building sources it contributes
src/libecoPCR/%.o: ../src/libecoPCR/%.c
@echo 'Building file: $<'
@echo 'Invoking: GCC C Compiler'
gcc -DMAC_OS_X -O0 -g3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
@echo 'Finished building: $<'
@echo ' '
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
# Add inputs and outputs from these tool invocations to the build variables
C_SRCS += \
../src/ecopcr.c
OBJS += \
./src/ecopcr.o
C_DEPS += \
./src/ecopcr.d
# Each subdirectory must supply rules for building sources it contributes
src/%.o: ../src/%.c
@echo 'Building file: $<'
@echo 'Invoking: GCC C Compiler'
gcc -DMAC_OS_X -O0 -g3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
@echo 'Finished building: $<'
@echo ' '
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
-include ../makefile.init
RM := rm -rf
# All of the sources participating in the build are defined here
-include sources.mk
-include subdir.mk
-include src/libecoPCR/subdir.mk
-include src/libapat/subdir.mk
-include src/subdir.mk
-include objects.mk
ifneq ($(MAKECMDGOALS),clean)
ifneq ($(strip $(C_DEPS)),)
-include $(C_DEPS)
endif
endif
-include ../makefile.defs
# Add inputs and outputs from these tool invocations to the build variables
# All Target
all: ecoPCR
# Tool invocations
ecoPCR: $(OBJS) $(USER_OBJS)
@echo 'Building target: $@'
@echo 'Invoking: MacOS X C Linker'
gcc -o "ecoPCR" $(OBJS) $(USER_OBJS) $(LIBS)
@echo 'Finished building target: $@'
@echo ' '
# Other Targets
clean:
-$(RM) $(OBJS)$(EXECUTABLES)$(C_DEPS) ecoPCR
-@echo ' '
.PHONY: all clean dependents
.SECONDARY:
-include ../makefile.targets
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
LIBS := -lz
USER_OBJS :=
\ No newline at end of file
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
C_SRCS :=
O_SRCS :=
ASM_SRCS :=
S_SRCS :=
OBJ_SRCS :=
OBJS :=
EXECUTABLES :=
C_DEPS :=
# Every subdirectory with source files must be described here
SUBDIRS := \
src/libecoPCR \
src/libapat \
src \
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
# Add inputs and outputs from these tool invocations to the build variables
C_SRCS += \
../src/libapat/apat_parse.c \
../src/libapat/apat_search.c \
../src/libapat/libstki.c
OBJS += \
./src/libapat/apat_parse.o \
./src/libapat/apat_search.o \
./src/libapat/libstki.o
C_DEPS += \
./src/libapat/apat_parse.d \
./src/libapat/apat_search.d \
./src/libapat/libstki.d
# Each subdirectory must supply rules for building sources it contributes
src/libapat/%.o: ../src/libapat/%.c
@echo 'Building file: $<'
@echo 'Invoking: GCC C Compiler'
gcc -DMAC_OS_X -O3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
@echo 'Finished building: $<'
@echo ' '
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
# Add inputs and outputs from these tool invocations to the build variables
C_SRCS += \
../src/libecoPCR/ecoError.c \
../src/libecoPCR/ecoIOUtils.c \
../src/libecoPCR/ecoMalloc.c \
../src/libecoPCR/ecoapat.c \
../src/libecoPCR/ecodna.c \
../src/libecoPCR/ecorank.c \
../src/libecoPCR/ecoseq.c \
../src/libecoPCR/ecotax.c
OBJS += \
./src/libecoPCR/ecoError.o \
./src/libecoPCR/ecoIOUtils.o \
./src/libecoPCR/ecoMalloc.o \
./src/libecoPCR/ecoapat.o \
./src/libecoPCR/ecodna.o \
./src/libecoPCR/ecorank.o \
./src/libecoPCR/ecoseq.o \
./src/libecoPCR/ecotax.o
C_DEPS += \
./src/libecoPCR/ecoError.d \
./src/libecoPCR/ecoIOUtils.d \
./src/libecoPCR/ecoMalloc.d \
./src/libecoPCR/ecoapat.d \
./src/libecoPCR/ecodna.d \
./src/libecoPCR/ecorank.d \
./src/libecoPCR/ecoseq.d \
./src/libecoPCR/ecotax.d
# Each subdirectory must supply rules for building sources it contributes
src/libecoPCR/%.o: ../src/libecoPCR/%.c
@echo 'Building file: $<'
@echo 'Invoking: GCC C Compiler'
gcc -DMAC_OS_X -O3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
@echo 'Finished building: $<'
@echo ' '
################################################################################
# Automatically-generated file. Do not edit!
################################################################################
# Add inputs and outputs from these tool invocations to the build variables
C_SRCS += \
../src/ecopcr.c
OBJS += \
./src/ecopcr.o
C_DEPS += \
./src/ecopcr.d
# Each subdirectory must supply rules for building sources it contributes
src/%.o: ../src/%.c
@echo 'Building file: $<'
@echo 'Invoking: GCC C Compiler'
gcc -DMAC_OS_X -O3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
@echo 'Finished building: $<'
@echo ' '
This diff is collapsed.
This diff is collapsed.
/* ----------------------------------------------- */
/* dft_pat_seq_code.h */
/* default alphabet encoding for alpha */
/* ----------------------------------------------- */
0x00000001 /* A */, 0x00000002 /* B */, 0x00000004 /* C */,
0x00000008 /* D */, 0x00000010 /* E */, 0x00000020 /* F */,
0x00000040 /* G */, 0x00000080 /* H */, 0x00000100 /* I */,
0x00000200 /* J */, 0x00000400 /* K */, 0x00000800 /* L */,
0x00001000 /* M */, 0x00002000 /* N */, 0x00004000 /* O */,
0x00008000 /* P */, 0x00010000 /* Q */, 0x00020000 /* R */,
0x00040000 /* S */, 0x00080000 /* T */, 0x00100000 /* U */,
0x00200000 /* V */, 0x00400000 /* W */, 0x00800000 /* X */,
0x01000000 /* Y */, 0x02000000 /* Z */
/* ----------------------------------------------- */
/* dna_code.h */
/* alphabet encoding for dna/rna */
/* ----------------------------------------- */
/* IUPAC encoding */
/* ----------------------------------------- */
/* G/A/T/C */
/* U=T */
/* R=AG */
/* Y=CT */
/* M=AC */
/* K=GT */
/* S=CG */
/* W=AT */
/* H=ACT */
/* B=CGT */
/* V=ACG */
/* D=AGT */
/* N=ACGT */
/* X=ACGT */
/* EFIJLOPQZ not recognized */
/* ----------------------------------------- */
/* dual encoding */
/* ----------------------------------------- */
/* A=ADHMNRVW */
/* B=BCDGHKMNRSTUVWY */
/* C=BCHMNSVY */
/* D=ABDGHKMNRSTUVWY */
/* G=BDGKNRSV */
/* H=ABCDHKMNRSTUVWY */
/* K=BDGHKNRSTUVWY */
/* M=ABCDHMNRSVWY */
/* N=ABCDGHKMNRSTUVWY */
/* R=ABDGHKMNRSVW */
/* S=BCDGHKMNRSVY */
/* T=BDHKNTUWY */
/* U=BDHKNTUWY */
/* V=ABCDGHKMNRSVWY */
/* W=ABDHKMNRTUVWY */
/* X=ABCDGHKMNRSTUVWY */
/* Y=BCDHKMNSTUVWY */
/* EFIJLOPQZ not recognized */
/* ----------------------------------------------- */
#ifndef USE_DUAL
/* IUPAC */
0x00000001 /* A */, 0x00080044 /* B */, 0x00000004 /* C */,
0x00080041 /* D */, 0x00000000 /* E */, 0x00000000 /* F */,
0x00000040 /* G */, 0x00080005 /* H */, 0x00000000 /* I */,
0x00000000 /* J */, 0x00080040 /* K */, 0x00000000 /* L */,
0x00000005 /* M */, 0x00080045 /* N */, 0x00000000 /* O */,
0x00000000 /* P */, 0x00000000 /* Q */, 0x00000041 /* R */,
0x00000044 /* S */, 0x00080000 /* T */, 0x00080000 /* U */,
0x00000045 /* V */, 0x00080001 /* W */, 0x00080045 /* X */,
0x00080004 /* Y */, 0x00000000 /* Z */
#else
/* DUAL */
0x00623089 /* A */, 0x017e34ce /* B */, 0x01243086 /* C */,
0x017e34cb /* D */, 0x00000000 /* E */, 0x00000000 /* F */,
0x0026244a /* G */, 0x017e348f /* H */, 0x00000000 /* I */,
0x00000000 /* J */, 0x017e24ca /* K */, 0x00000000 /* L */,
0x0166308f /* M */, 0x017e34cf /* N */, 0x00000000 /* O */,
0x00000000 /* P */, 0x00000000 /* Q */, 0x006634cb /* R */,
0x012634ce /* S */, 0x0158248a /* T */, 0x0158248a /* U */,
0x016634cf /* V */, 0x017a348b /* W */, 0x017e34cf /* X */,
0x017c348e /* Y */, 0x00000000 /* Z */
#endif
/* ----------------------------------------------- */
/* prot_code.h */
/* alphabet encoding for proteins */
/* ----------------------------------------- */
/* IUPAC encoding */
/* ----------------------------------------- */
/* B=DN */
/* Z=EQ */
/* X=any - {X} */
/* JOU not recognized */
/* ----------------------------------------- */
/* dual encoding */
/* ----------------------------------------- */
/* B=BDN */
/* D=BD */
/* E=EZ */
/* N=BN */
/* Q=QZ */
/* X=any - {X} */
/* Z=EQZ */
/* JOU not recognized */
/* ----------------------------------------------- */
#ifndef USE_DUAL
/* IUPAC */
0x00000001 /* A */, 0x00002008 /* B */, 0x00000004 /* C */,
0x00000008 /* D */, 0x00000010 /* E */, 0x00000020 /* F */,
0x00000040 /* G */, 0x00000080 /* H */, 0x00000100 /* I */,
0x00000000 /* J */, 0x00000400 /* K */, 0x00000800 /* L */,
0x00001000 /* M */, 0x00002000 /* N */, 0x00000000 /* O */,
0x00008000 /* P */, 0x00010000 /* Q */, 0x00020000 /* R */,
0x00040000 /* S */, 0x00080000 /* T */, 0x00000000 /* U */,
0x00200000 /* V */, 0x00400000 /* W */, 0x037fffff /* X */,
0x01000000 /* Y */, 0x00010010 /* Z */
#else
/* DUAL */
0x00000001 /* A */, 0x0000200a /* B */, 0x00000004 /* C */,
0x0000000a /* D */, 0x02000010 /* E */, 0x00000020 /* F */,
0x00000040 /* G */, 0x00000080 /* H */, 0x00000100 /* I */,
0x00000000 /* J */, 0x00000400 /* K */, 0x00000800 /* L */,
0x00001000 /* M */, 0x00002002 /* N */, 0x00000000 /* O */,
0x00008000 /* P */, 0x02010000 /* Q */, 0x00020000 /* R */,
0x00040000 /* S */, 0x00080000 /* T */, 0x00000000 /* U */,
0x00200000 /* V */, 0x00400000 /* W */, 0x037fffff /* X */,
0x01000000 /* Y */, 0x02010010 /* Z */
#endif
/* ---------------------------------------------------------------- */
/* Copyright (c) Atelier de BioInformatique */
/* @file: Gmach.h */
/* @desc: machine dependant setup */
/* @+ *should* be included in all ABI softs */
/* */
/* @history: */
/* @+ <Gloup> : Jul 95 : MWC first draft */
/* @+ <Gloup> : Jan 96 : adapted to Pwg */
/* @+ <Gloup> : Nov 00 : adapted to Mac_OS_X */
/* ---------------------------------------------------------------- */
#ifndef _H_Gmach
/* OS names */
#define _H_Gmach
/* Macintosh Classic */
/* Think C environment */
#ifdef THINK_C
#define MACINTOSH
#define MAC_OS_C
#endif
/* Macintosh Classic */
/* Code-Warrior */
#ifdef __MWERKS__
#define MACINTOSH
#define MAC_OS_C
#endif
/* Macintosh OS-X */
#ifdef MAC_OS_X
#define MACINTOSH
#define UNIX
#define UNIX_BSD
#endif
/* LINUX */
#ifdef LINUX
#define UNIX
#define UNIX_BSD
#endif
/* other Unix Boxes */
/* SunOS / Solaris */
#ifdef SUN
#define UNIX
#ifdef SOLARIS
#define UNIX_S7
#else
#define UNIX_BSD
#endif
#endif
/* SGI Irix */
#ifdef SGI
#define UNIX
#define UNIX_S7
#endif
/* ansi setup */
/* for unix machines see makefile */
#ifndef PROTO
#define PROTO 1
#endif
#ifndef ANSI_PROTO
#define ANSI_PROTO PROTO
#endif
#ifndef ANSI_STR
#define ANSI_STR 1
#endif
/* unistd.h header file */
#ifdef UNIX
#define HAS_UNISTD_H <unistd.h>
#endif
/* getopt.h header file */
#ifdef MAC_OS_C
#define HAS_GETOPT_H "getopt.h"
#endif
#ifdef SGI
#define HAS_GETOPT_H <getopt.h>
#endif
#endif
/* ---------------------------------------------------------------- */
/* Copyright (c) Atelier de BioInformatique */
/* @file: Gtypes.h */
/* @desc: general & machine dependant types */
/* @+ *should* be included in all ABI softs */
/* */
/* @history: */
/* @+ <Gloup> : Jan 91 : MWC first draft */
/* @+ <Gloup> : Jul 95 : Gmach addition */
/* ---------------------------------------------------------------- */
#define _H_Gtypes
#ifndef _H_Gmach
#include "Gmach.h"
#endif
#ifndef NULL
#include <stdio.h> /* is the official NULL here ? */
#endif
/* ==================================================== */
/* constantes */
/* ==================================================== */
#ifndef PROTO
#define PROTO 1 /* prototypes flag */
#endif
#ifdef MAC_OS_C
#define Vrai true /* TC boolean values */
#define Faux false /* */
#else
#define Vrai 0x1 /* bool values = TRUE */
#define Faux 0x0 /* = FALSE */
#endif
#define Nil NULL /* nil pointer */
#define kBigInt16 0x7fff /* plus grand 16 bits signe */
#define kBigInt32 0x7fffffff /* plus grand 32 bits signe */
#define kBigUInt16 0xffff /* plus grand 16 bits ~signe */
#define kBigUInt32 0xffffffff /* plus grand 32 bits ~signe */
#ifdef MAC_OS_C
/* ==================================================== */
/* Types (for Macintosh ThinK C || MWerks) */
/* ==================================================== */
/* --- specific sizes --------- */
typedef long Int32; /* Int32 = 32 bits signe */
typedef unsigned long UInt32; /* UInt32 = 32 bits ~signe */
typedef short Int16; /* Int16 = 16 bits signe */
typedef unsigned short UInt16; /* UInt32 = 16 bits ~signe */
typedef char Int8; /* Int8 = 8 bits signe */
typedef unsigned char UInt8; /* UInt8 = 8 bits ~signe */
/* --- default types ---------- */
typedef Boolean Bool; /* booleen */
typedef long Int; /* 'natural' int (>= 32 bits) */
typedef void *Ptr; /* pointeur */