Initial commit

.gitignore

+/man/

DESCRIPTION

+Package: ROBIBarcodes
+Type: Package
+Title: Metabarcoding barcode database
+Version: 0.1
+Date: 2013-10-24
+Author: LECA - Laboratoire d'ecologie alpine
+Maintainer: LECA OBITools team <obitools@metabarcoding.org>
+Description: More about what it does (maybe more than one line)
+License: CeCILL v2.0
+LazyLoad: yes
+RoxygenNote: 5.0.1
+Collate:
+    'ROBIBarcodes.R'
+    'xmlMods.R'
+    'bibliography.R'
+    'ecopcr.R'
+    'emptydb.R'
+    'logo.R'
+    'mismatchplot.R'
+    'piexy.R'
+    'primer_table.R'
+    'primers.R'
+    'resolution.R'
+    'taxonomy.R'
+    'taxonomy_table.R'
+    'xmlspare.R'

NAMESPACE

+# Generated by roxygen2: do not edit by hand
+
+export(add.reference.barcodedb)
+export(add.taxon.barcodedb)
+export(addmodsnamespace)
+export(bezier3)
+export(bib2mods)
+export(dna.shanon)
+export(dnalogo)
+export(dnalogoplot)
+export(ecopcr.forward.frequencies)
+export(ecopcr.forward.shanon)
+export(ecopcr.reverse.frequencies)
+export(ecopcr.reverse.shanon)
+export(has.bibliography)
+export(metabarcodedb)
+export(metabarcodedb.taxonomy)
+export(mismatchplot)
+export(pie.xy)
+export(plotDNAletter)
+export(primers.data.frame)
+export(read.ecopcr.result)
+export(resolution)
+export(taxonomy.data.frame)
+export(whitepaper)
+import(ROBITaxonomy)
+import(XML)
+useDynLib(ROBIBarcodes)

R/ROBIBarcodes.R

+#' A package to manipulate DNA metabarcoding data.
+#' 
+#' This package was written as a following of the OBITools. 
+#' 
+#' \tabular{ll}{
+#'  Package: \tab ROBIBarcodes\cr
+#'  Type: \tab Package\cr
+#'  Version: \tab 0.1\cr
+#'  Date: \tab 2013-06-27\cr
+#'  License: \tab CeCILL 2.0\cr
+#'  LazyLoad: \tab yes\cr
+#'}
+#' 
+#' @name ROBIBarcodes-package
+#' @aliases ROBIBarcodes
+#' @docType package
+#' @title  A package to manipulate DNA metabarcoding marker database.
+#' @author Frederic Boyer
+#' @author Aurelie Bonin
+#' @author Lucie Zinger
+#' @author Eric Coissac
+#' 
+#' @references http://metabarcoding.org/obitools
+#' 
+NULL

R/bibliography.R

+#'@include xmlMods.R
+#'@import XML
+#'
+NULL
+
+#' Tests if the metabarcode database has at least one bibliography reference
+#' 
+#' @export
+has.bibliography = function(barcodedb) {
+  length(getNodeSet(barcodedb,
+                    path='/obi:obimetabarcodedb/obi:bibliography',
+                    c(obi="http://metabarcoding.org/OBIMetabarcodes")))>0
+}
+
+#' @export
+add.reference.barcodedb  = function(barcodedb,bibfile,bibutils='bib2xml') {
+  
+  if (! has.bibliography(barcodedb)) {
+    # We create the bibliography node
+    
+    metabarcode = getNodeSet(barcodedb,
+                          path='/obi:obimetabarcodedb',
+                          c(obi="http://metabarcoding.org/OBIMetabarcodes"))[[1]]
+    
+    spare = sparexmltree()
+    
+    bibliography = getNodeSet(spare,
+                          path='/obi:obimetabarcodedb/obi:bibliography',
+                          c(obi="http://metabarcoding.org/OBIMetabarcodes"))[[1]]
+    
+    bibliography = xmlClone(bibliography)
+    
+    addChildren(metadata,bibliography,
+                at = NA)
+    
+
+  }
+
+  bibliography=getNodeSet(barcodedb,
+                          path='/obi:obimetabarcodedb/obi:bibliography',
+                          c(obi="http://metabarcoding.org/OBIMetabarcodes"))
+  
+  ref = bib2mods(bibfile,bibutils)
+  hidden=addChildren(bibliography[[1]],kids=ref) 
+}
\ No newline at end of file

R/ecopcr.R

+#'@include ROBIBarcodes.R
+NULL
+
+#   column 1 : accession number
+#   column 2 : sequence length
+#   column 3 : taxonomic id
+#   column 4 : rank
+#   column 5 : species taxonomic id
+#   column 6 : scientific name
+#   column 7 : genus taxonomic id
+#   column 8 : genus name
+#   column 9 : family taxonomic id
+#   column 10 : family name
+#   column 11 : super kingdom taxonomic id
+#   column 12 : super kingdom name
+#   column 13 : strand (direct or reverse)
+#   column 14 : first oligonucleotide
+#   column 15 : number of errors for the first strand
+#   column 16 : Tm for hybridization of primer 1 at this site
+#   column 17 : second oligonucleotide
+#   column 18 : number of errors for the second strand
+#   column 19 : Tm for hybridization of primer 1 at this site
+#   column 20 : amplification length
+#   column 21 : sequence
+#   column 22 : definition  
+
+#' Read the result file produced by the ecoPCR program.
+#' 
+#' @export
+read.ecopcr.result = function(file) 
+{
+  
+  split.line = function(line) {
+    l = strsplit(line,split=" +\\| +")[[1]]
+    l = c(l[1:21],paste(l[-c(1:21)],sep="|"))
+    return(l)
+  }
+  
+  if (missing(file) && !missing(text)) {
+    file <- textConnection(text)
+    on.exit(close(file))
+  }
+  if (is.character(file)) {
+    file <- file(file, "rt")
+    on.exit(close(file))
+  }
+  if (!inherits(file, "connection")) 
+    stop("'file' must be a character string or connection")
+  if (!isOpen(file, "rt")) {
+    open(file, "rt")
+    on.exit(close(file))
+  }
+  
+  line = readLines(file,1)
+  while (length(grep('^#',line))==1) {
+    line = readLines(file,1)
+  }
+  
+  pushBack(line,file)
+  
+  lines = lapply(readLines(file),split.line)
+  nlines = length(lines)
+  AC                = sapply(1:nlines,function(x) lines[[x]][1])
+  seq_length        = as.integer(sapply(1:nlines,function(x) lines[[x]][2]))
+  taxid             = as.integer(sapply(1:nlines,function(x) lines[[x]][3]))
+  rank              = as.factor(sapply(1:nlines,function(x) lines[[x]][4]))
+  species           = type.convert(sapply(1:nlines,function(x) lines[[x]][5]),na.string="###")
+  species_name      = sapply(1:nlines,function(x) lines[[x]][6])
+  genus             = type.convert(sapply(1:nlines,function(x) lines[[x]][7]),na.string="###")
+  genus_name        = sapply(1:nlines,function(x) lines[[x]][8])
+  family            = type.convert(sapply(1:nlines,function(x) lines[[x]][9]),na.string="###")
+  family_name       = sapply(1:nlines,function(x) lines[[x]][10])
+  superkingdom      = type.convert(sapply(1:nlines,function(x) lines[[x]][11]),na.string="###")
+  superkingdom_name = sapply(1:nlines,function(x) lines[[x]][12])
+  strand            = as.factor(sapply(1:nlines,function(x) lines[[x]][13]))
+  forward_match     = sapply(1:nlines,function(x) lines[[x]][14])
+  forward_mismatch  = as.integer(sapply(1:nlines,function(x) lines[[x]][15]))
+  forward_tm        = as.double(sapply(1:nlines,function(x) lines[[x]][16]))
+  reverse_match     = sapply(1:nlines,function(x) lines[[x]][17])
+  reverse_mismatch  = as.integer(sapply(1:nlines,function(x) lines[[x]][18]))
+  reverse_tm        = as.double(sapply(1:nlines,function(x) lines[[x]][19]))
+  amplicon_length   = as.integer(sapply(1:nlines,function(x) lines[[x]][20]))
+  sequence          = sapply(1:nlines,function(x) lines[[x]][21])
+  definition        = sapply(1:nlines,function(x) lines[[x]][22])
+  
+  eco = data.frame(AC,seq_length,taxid,rank,
+                   species,species_name,
+                   genus,genus_name,
+                   family,family_name,
+                   superkingdom,superkingdom_name,
+                   strand,
+                   forward_match,forward_mismatch,forward_tm,
+                   reverse_match,reverse_mismatch,reverse_tm,
+                   amplicon_length,sequence,definition
+  )
+  
+  return(eco)
+}
+
+ecopcr.frequencies = function(matches,group=NULL) {
+  compute = function(matches) {
+    w = as.matrix(do.call(rbind,strsplit(as.character(matches),'')))
+    d = dim(w)
+    w=factor(w,levels=c('A','C','G','T'))
+    dim(w)=d
+    w=t(w)
+    freq = mapply(function(x) table(w[x,]),1:d[2])
+    freq = freq[c('A','C','G','T'),]
+    csum = colSums(freq)
+    freq = sweep(freq,2,csum,'/')
+    attr(freq,'count')=length(w)
+    return(freq)
+  }
+  if (is.null(group))
+    return(compute(matches))
+  else {
+    lmatches = aggregate(matches,by=list(group=as.factor(group)),as.character)
+    w = lmatches$x
+    names(w)=lmatches$group
+    lf = lapply(w,compute)
+    return(lf)
+  }
+}
+
+#' @export
+ecopcr.forward.frequencies = function(ecopcr,group=NULL) {
+  return(ecopcr.frequencies(ecopcr$forward_match,group))
+}
+
+#' @export
+ecopcr.reverse.frequencies = function(ecopcr,group=NULL) {
+  return(ecopcr.frequencies(ecopcr$reverse_match,group))
+}
+
+#' @export
+dna.shanon = function(freq,base=2) {
+  shanon = log(4)/log(base) - colSums(-freq *log(freq) / log(base),na.rm=TRUE)
+  return(sweep(freq,2,shanon,'*')) 
+}
+
+
+ecopcr.shanon = function(matches,group=NULL,base=2) {
+  
+  if (is.null(group)) {
+    freq = ecopcr.frequencies(matches)
+    return(dna.shanon(freq))
+  }
+  else {
+    lf = lapply(ecopcr.frequencies(matches,group),dna.shanon)
+    return(lf)
+  }
+}
+
+#' @export
+ecopcr.forward.shanon = function(ecopcr,group=NULL,base=2) {
+  return(ecopcr.shanon(ecopcr$forward_match,group,base))
+}
+
+#' @export
+ecopcr.reverse.shanon = function(ecopcr,group=NULL,base=2) {
+  return(ecopcr.shanon(ecopcr$reverse_match,group,base))
+}

R/emptydb.R

+#'@include ROBIBarcodes.R
+#'@import XML
+#'
+NULL
+
+#' Creates a new empty metabarcode database.
+#' 
+#' @export
+metabarcodedb = function() {
+  emptyfile = paste(system.file("extdata", 
+                                package="ROBIBarcodes"),
+                    'empty.xml',
+                    sep='/')
+
+ empty = xmlParseDoc(emptyfile)
+
+ return(empty)
+}
\ No newline at end of file

R/mismatchplot.R

+#'@include ROBIBarcodes.R
+#'@include logo.R
+NULL
+
+#' Draw a scatter plot of the reverse mismatches as a function of forward mismatches.
+#' 
+#' The \code{mismatchplot} function draws a scatter plot of the number of mismatches
+#' observed in an ecoPCR result for the reverse primer as a function of the mismatches
+#' for the reverse primer. Each point for a pair (forward_mismatch,reverse_mismatch) is
+#' drawn as a circle having a surface proportional to the aboundance of this pair in the
+#' results. If a grouping factor is specified, then the circle is replaced by a pie chart.
+#' 
+#' @param ecopcr an ecoPCR result data.frame as returned by the \code{\link{read.ecopcr.result}}
+#'               function. 
+#'               
+#' @param group  a factor decribing classes amongst the amplicon described in the ecoPCR
+#'               result
+#'               
+#' @param col    a vector describing the colored used for the bubble or the pie charts
+#' 
+#' @param legend a character vector describing the legend for each modality of the
+#'               grouping factor. By default the factor levels are used for the legend
+#'               
+#' @param legend.cex the expension factor for the legend text
+#' 
+#' @param inset  the distance to the margin of the legend box (see the \code{\link{legend}} 
+#'               documentation)
+#'               
+#' @examples
+#' 
+#' # Load the ROBITools library
+#' library(ROBITools)
+#' 
+#' # Load the default taxonomy
+#' taxo = default.taxonomy()
+#' 
+#' # Load the sample ecoPCR data file
+#' data(GH.ecopcr)
+#' 
+#' # Computes classes associated to each taxid 
+#' orders = as.factor(taxonatrank(taxo,GH.ecopcr$taxid,'order',name=T))
+#' 
+#' # Plot the graph
+#' mismatchplot(GH.ecopcr,group=orders)
+#' 
+#' @seealso \code{\link{read.ecopcr.result}}
+#' @author Eric Coissac
+#' @export
+mismatchplot = function(ecopcr,group=NULL,
+                        col=NULL,legend=NULL,
+                        legend.cex=0.7,inset=c(0.02,0.02)) {
+  
+  maxforward_error = max(ecopcr$forward_mismatch)
+  maxreverse_error = max(ecopcr$reverse_mismatch)
+  maxerror=max(maxforward_error,maxreverse_error)
+
+  if (is.null(group))
+    group=factor(rep("all",dim(ecopcr)[1]))
+  else
+    group=as.factor(group)
+  
+  if (is.null(legend))
+    legend = levels(group)
+  
+  actualheight= maxerror + 1
+  actualwidth = maxerror + 1
+  
+  if (length(levels(group)) > 1)
+    actualwidth = actualwidth + 2
+  
+  whitepaper(actualwidth,actualheight,xmin=-0.5,ymin=-0.5,asp=1)
+  
+  axis(1,at=0:maxerror,
+       labels=0:maxerror)
+  
+  axis(2,at=0:maxerror,
+       labels=0:maxerror)
+  
+  
+  data = aggregate(group,by=list(forward=ecopcr$forward_mismatch,
+                            reverse=ecopcr$reverse_mismatch),
+                   table)
+  
+  data <- data[rowSums(data[,c(-1,-2),drop=FALSE])>0, , drop=FALSE]
+  
+  if (is.null(col)) 
+    col <- c("white", "lightblue", "mistyrose", "lightcyan", 
+             "lavender", "cornsilk")
+  
+  
+  value=data[,c(-1,-2),drop=FALSE]
+  x = as.integer(data[,1])
+  y = as.integer(data[,2])
+  diam = sqrt(rowSums(value))
+  radius = diam / max(diam) / 2
+  
+  hide = mapply(pie.xy,x,y,
+                data=lapply(1:(dim(value)[1]),function(y) value[y,]),
+                radius=radius,
+                label="",MoreArgs=list(col=col))
+  
+  
+  if (length(levels(group)) > 1)
+    legend('topright',legend=legend,fill=col, cex=legend.cex, inset=inset)
+  
+}
\ No newline at end of file

R/piexy.R

+#'@include ROBIBarcodes.R
+NULL
+
+#' @export
+pie.xy = function (x,y,data, labels = names(x), edges = 200, radius = 0.8, clockwise = FALSE, 
+          init.angle = if (clockwise) 90 else 0, density = NULL, angle = 45, 
+          col = NULL, border = NULL, lty = NULL, ...) 
+{
+  if (!is.numeric(data) || any(is.na(data) | data < 0)) 
+    stop("'data' values must be positive.")
+  if (is.null(labels)) 
+    labels <- as.character(seq_along(data))
+  else labels <- as.graphicsAnnot(labels)
+  data <- c(0, cumsum(data)/sum(data))
+  dx <- diff(data)
+  nx <- length(dx)
+#  plot.new()
+#  pin <- par("pin")
+  xlim <- ylim <- c(-1, 1)
+#   if (pin[1L] > pin[2L]) 
+#     xlim <- (pin[1L]/pin[2L]) * xlim
+#   else ylim <- (pin[2L]/pin[1L]) * ylim
+#  dev.hold()
+#  on.exit(dev.flush())
+#  plot.window(xlim, ylim, "", asp = 1)
+  if (is.null(col)) 
+    col <- if (is.null(density)) 
+      c("white", "lightblue", "mistyrose", "lightcyan", 
+        "lavender", "cornsilk")
+  else par("fg")
+  if (!is.null(col)) 
+    col <- rep_len(col, nx)
+  if (!is.null(border)) 
+    border <- rep_len(border, nx)
+  if (!is.null(lty)) 
+    lty <- rep_len(lty, nx)
+  angle <- rep(angle, nx)
+  if (!is.null(density)) 
+    density <- rep_len(density, nx)
+  twopi <- if (clockwise) 
+    -2 * pi
+  else 2 * pi
+  t2xy <- function(t) {
+    t2p <- twopi * t + init.angle * pi/180
+    list(x = radius * cos(t2p) , y = radius * sin(t2p))
+  }
+  for (i in 1L:nx) {
+    n <- max(2, floor(edges * dx[i]))
+    P <- t2xy(seq.int(data[i], data[i + 1], length.out = n))
+    if (nx>1)
+      polygon(c(P$x + x, x), c(P$y + y , y), 
+              density = density[i], angle = angle[i], 
+              border = border[i], col = col[i], lty = lty[i])
+    else
+      polygon(P$x + x, P$y + y, 
+              density = density[i], angle = angle[i], 
+              border = border[i], col = col[i], lty = lty[i])
+    P <- t2xy(mean(data[i + 0:1]))
+    lab <- as.character(labels[i])
+    if (!is.na(lab) && nzchar(lab)) {
+      lines(c(1 , 1.05) * P$x + x, c(1, 1.05) * P$y + y)
+      text(1.1 * P$x + x , 1.1 * P$y + y, labels[i], xpd = TRUE, 
+           adj = ifelse(P$x < 0, 1, 0), ...)
+    }
+  }
+#  title(main = main, ...)
+  invisible(NULL)
+}
\ No newline at end of file

R/primer_table.R

+#Commentaires lus par roxygen
+#'@include ROBIBarcodes.R
+#'@import XML
+#'
+NULL
+
+#NULL termine le commentaire pour roxygen
+
+extractPrimers <-function(primer){
+  
+  id=xmlAttrs(primer)["ID"]
+  name=xmlValue(xmlChildren(xmlChildren(primer)$name)$text)
+  sequence=xmlValue(xmlChildren(xmlChildren(primer)$sequence)$text)
+  coding=as.logical(xmlValue(xmlChildren(xmlChildren(primer)$coding)$text))
+  
+  p=list(id=id, name=name, sequence=sequence, coding=coding)
+  
+  return(p)
+}
+
+#Export pour rendre publique la fonction
+
+#' Builds primer data frame from metabarcodedb
+#' 
+#' The \code{primers.data.frame} function extracts all the primer information
+#' from the \code{metabarcodedb} database.
+#' 
+#' @param barcodedb a xml document containing a metabarcodedb.
+#' 
+#' @return a \code{data.frame} describing primers.
+#' 
+#' @examples
+#' # load the XML library
+#' library(XML)
+#' 
+#' # load the example metabarcodedb database
+#' db = xmlParseDoc(system.file("extdata/barcodedb.xml", package="ROBIBarcodes"))
+#' 
+#' # extracts the primer table
+#' primers.data.frame(db)
+#' 
+#' @author Aurelie Bonin
+#' @keywords metabarcodes
+#' 
+#' @export
+primers.data.frame <-function(barcodedb){
+  p=getNodeSet(db, 
+               path="/obi:obimetabarcodedb/obi:primers/obi:primer" , 
+               namespaces=c(obi="http://metabarcoding.org/OBIMetabarcodes"))
+
+  primerTable=as.data.frame(do.call(rbind,lapply(p,extractPrimers)))
+
+  rownames(primerTable)=primerTable$id
+  primerTable=primerTable[,-1]
+  
+  return(primerTable)
+}

R/primers.R

+#'@include xmlMods.R
+#'@import XML
+#'
+NULL
+
+
+add.primer.barcodedb = function(barcodedb,
+                               name,
+                               sequence,
+                               coding,
+                               documentation) {
+'  <primer ID="PR.XXX">
+    <name>Xxx</name>
+    <sequence>CGATCGATGCTAGCTAGCTGAT</sequence>
+    <coding>false</coding>
+    </primer>'
+  
+}
\ No newline at end of file

R/resolution.R

+#'@import ROBITaxonomy
+#'@include ROBIBarcodes.R
+NULL
+
+
+#'@export
+resolution = function(taxonomy,ecopcr) {
+  l = aggregate(ecopcr$taxid,
+                by=list(barcode=ecopcr$sequence),
+                function(x) lowest.common.ancestor(taxo,x))
+  r = taxonomicrank(taxo,l$x)
+  names(r)=as.character(l$barcode)
+  
+  return(r[as.character(ecopcr$sequence)])
+}
\ No newline at end of file

R/taxonomy.R

+#'@include xmlMods.R
+#'@import XML
+#'@import ROBITaxonomy
+#'@include ROBIBarcodes.R
+NULL
+
+
+taxon.data.frame  = function(taxonomy,taxids,strict=TRUE,known.taxid=c()) {
+  taxids = as.integer(sub("TX.","",as.character(taxids)))
+  good.taxid =  validate(taxonomy,taxids)
+  
+  if (strict & any(is.na(good.taxid))) 
+    stop(sprintf("The following taxids are absent from the taxonomy : %s",
+                 toString(taxids[is.na(good.taxid)])))
+  
+  good.taxid = good.taxid[! is.na(good.taxid)]
+  all.path   = path(taxonomy,good.taxid)
+  all.taxid  = Reduce(union,all.path)
+  all.taxid  = sort(union(all.taxid,known.taxid))[-1]
+  all.parent = sprintf("TX.%d",parent(taxonomy,all.taxid))
+  all.rank   = taxonomicrank(taxonomy,all.taxid)
+  all.scientificname = scientificname(taxonomy,all.taxid)
+  
+  all.id = sprintf("TX.%d",all.taxid)
+  
+  rep = data.frame(taxid=all.id,
+                   name=all.scientificname,
+                   rank=all.rank,
+                   partof=all.parent,
+                   stringsAsFactors=FALSE)
+  
+  return(rep)
+}
+
+build.taxon.node = function(taxid,name,rank,partof) {
+  nodes = lapply(sprintf('\n<taxon ID="%s"><name>%s</name><rank>%s</rank><partof>%s</partof></taxon>',
+                     taxid,
+                     name,
+                     rank,
+                     partof),
+                 xmlParseString)
+  
+  
+  return(nodes)
+  
+}
+
+#'@export
+add.taxon.barcodedb = function(barcodedb,
+                                   taxonomy,
+                                   taxids) {
+  
+  taxonomy.node = getNodeSet(barcodedb,
+                        path='/obi:obimetabarcodedb/obi:taxonomy',
+                        c(obi="http://metabarcoding.org/OBIMetabarcodes"))[[1]]
+  
+  known.taxid = as.character(
+                  getNodeSet(
+                    taxonomy.node,
+                    path="./obi:taxon/@ID",
+                    c(obi="http://metabarcoding.org/OBIMetabarcodes")))
+    
+  known.taxid = as.integer(sub("TX.","",known.taxid))
+  
+  taxon = taxon.data.frame(taxonomy,taxids,strict=TRUE,known.taxid)
+  
+  taxon.nodes = c(xmlChildren(taxonomy.node)$root,
+                  build.taxon.node(taxon$taxid,
+                                 taxon$name,
+                                 taxon$rank,
+                                 taxon$partof))
+  spare = sparexmltree()
+  new.taxonomy.node =  getNodeSet(spare,
+                                  path='/obi:obimetabarcodedb/obi:taxonomy',
+                                  c(obi="http://metabarcoding.org/OBIMetabarcodes"))[[1]]
+  
+  replaceNodes(taxonomy.node,new.taxonomy.node)
+  
+  hidden = addChildren(new.taxonomy.node,kids=taxon.nodes,append=FALSE)
+}
+

R/taxonomy_table.R

+#' @include ROBIBarcodes.R
+#' @import  ROBITaxonomy
+#' @import XML
+#' @useDynLib ROBIBarcodes
+#'
+NULL
+
+
+extractTaxa <-function(taxon){
+  
+  id=xmlAttrs(taxon)["ID"]
+  name=xmlValue(xmlChildren(xmlChildren(taxon)$name)$text)
+  rank=xmlValue(xmlChildren(xmlChildren(taxon)$rank)$text)
+  partof=xmlValue(xmlChildren(xmlChildren(taxon)$partof)$text)
+  
+  p=list(id=id, name=name, rank=rank, partof=partof)
+  
+  return(p)
+}
+
+#' Builds taxa data frame from metabarcodedb
+#' 
+#' The \code{taxonomy.data.frame} function extracts all the taxon information
+#' from the \code{metabarcodedb} database.
+#' 
+#' @param barcodedb a xml document containing a metabarcodedb.
+#' 
+#' @return a \code{data.frame} describing taxa.
+#' 
+#' @examples
+#' # load the XML library
+#' library(XML)
+#' 
+#' # load the example metabarcodedb database
+#' db = xmlParseDoc(system.file("extdata/barcodedb.xml", package="ROBIBarcodes"))
+#' 
+#' # extracts the taxonomy table
+#' taxonomy.data.frame(db)
+#'